Mutagenetix > Incidental Mutations

Incidental Mutation 'R0840:Morc2b'

List |< first << previous [record 27 of 51] next >> last >|

77143

Institutional Source

Beutler Lab

Gene Symbol

Morc2b

Ensembl Gene

ENSMUSG00000048602

Gene Name

microrchidia 2B

Synonyms

MMRRC Submission

039019-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.338) question?

Stock #

R0840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33135588-33139683 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 33136112 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 895 (H895Q)

Ref Sequence

ENSEMBL: ENSMUSP00000123354 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]

Predicted Effect

probably benign
Transcript: ENSMUST00000053896
AA Change: H895Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: H895Q

Domain	Start	End	E-Value	Type
HATPase_c	24	134	5.78e0	SMART
coiled coil region	285	321	N/A	INTRINSIC
Pfam:zf-CW	495	541	1.9e-16	PFAM
coiled coil region	555	584	N/A	INTRINSIC
low complexity region	680	695	N/A	INTRINSIC
coiled coil region	961	1001	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131954
AA Change: H895Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: H895Q

Domain	Start	End	E-Value	Type
HATPase_c	24	134	5.78e0	SMART
coiled coil region	285	321	N/A	INTRINSIC
Pfam:zf-CW	494	543	7.7e-18	PFAM
coiled coil region	555	584	N/A	INTRINSIC
low complexity region	680	695	N/A	INTRINSIC
coiled coil region	961	1001	N/A	INTRINSIC

Meta Mutation Damage Score

0.0873

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810020O05Rik	G	T	6: 87,680,278		noncoding transcript	Het
2700049A03Rik	C	G	12: 71,158,883	Q434E	probably benign	Het
A930011G23Rik	T	C	5: 99,234,688	T234A	probably benign	Het
Acot5	G	A	12: 84,075,840	W399*	probably null	Het
Adra1a	A	G	14: 66,727,710	E383G	possibly damaging	Het
Ahnak	T	A	19: 9,005,063	I1237N	probably damaging	Het
Bsg	A	G	10: 79,709,685	T28A	probably damaging	Het
Cacna1i	A	T	15: 80,358,949	I436F	possibly damaging	Het
Cd109	T	C	9: 78,664,330	I417T	probably benign	Het
Cep295	A	T	9: 15,334,315	D948E	probably benign	Het
Clcn3	C	A	8: 60,929,154	V467F	probably benign	Het
Cntnap3	T	C	13: 64,787,910	S380G	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dll4	T	A	2: 119,326,485	N79K	probably benign	Het
Ep300	A	T	15: 81,644,933	N1558I	unknown	Het
Fblim1	A	G	4: 141,581,009	F330L	possibly damaging	Het
Fbxo46	T	A	7: 19,137,148	M564K	possibly damaging	Het
Fnip1	T	A	11: 54,493,181		probably benign	Het
Foxl2	A	T	9: 98,955,931	K91*	probably null	Het
Gapvd1	C	A	2: 34,729,113	V83F	probably benign	Het
Guk1	G	A	11: 59,185,095	R146C	probably damaging	Het
Irf8	G	A	8: 120,753,481	G153S	probably benign	Het
Kcnu1	T	A	8: 25,913,684	M1K	probably null	Het
Krt32	G	A	11: 100,081,242	P427S	probably benign	Het
Lrp12	A	G	15: 39,876,158	S529P	probably damaging	Het
Mettl22	T	C	16: 8,482,157	V134A	probably damaging	Het
Nrros	T	C	16: 32,143,423	D556G	probably damaging	Het
Nrxn3	A	G	12: 90,331,793	S1367G	possibly damaging	Het
Olfr129	A	G	17: 38,055,572	F7S	probably benign	Het
Olfr504	A	T	7: 108,565,616	S60T	probably benign	Het
Pcnx3	T	A	19: 5,685,701		probably null	Het
Pgap2	A	T	7: 102,237,448	M226L	probably damaging	Het
Pik3c2g	A	G	6: 139,896,072	I616M	probably damaging	Het
Pisd	A	G	5: 32,737,312	I380T	probably damaging	Het
Pkhd1	T	C	1: 20,350,521	I2454V	probably damaging	Het
Plpp2	A	G	10: 79,527,544	I151T	probably benign	Het
Polr3a	G	A	14: 24,452,200	T1295I	possibly damaging	Het
Pot1a	T	C	6: 25,748,284		probably benign	Het
Prpf39	T	G	12: 65,048,206	N219K	probably benign	Het
Rnf17	T	A	14: 56,475,447	N790K	probably damaging	Het
Slit3	C	T	11: 35,623,436		probably benign	Het
Stx1a	T	A	5: 135,041,234		probably benign	Het
Tenm3	C	A	8: 48,335,742	V690F	probably damaging	Het
Tmcc3	A	G	10: 94,578,771	I143V	probably benign	Het
Tmem41b	G	A	7: 109,981,049	S36F	probably damaging	Het
Trim5	A	T	7: 104,265,771	W364R	probably damaging	Het
Ttn	T	C	2: 76,786,811	Y16403C	probably damaging	Het
Vps8	T	C	16: 21,456,321	S210P	probably damaging	Het
Zbtb3	T	A	19: 8,803,457	S145T	possibly damaging	Het
Zfp882	T	A	8: 71,914,686	C452*	probably null	Het

Other mutations in Morc2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01323:Morc2b	APN	17	33137319	missense	possibly damaging	0.47
IGL01369:Morc2b	APN	17	33138165	missense	probably benign	0.12
IGL01533:Morc2b	APN	17	33135721	utr 3 prime	probably benign
IGL02003:Morc2b	APN	17	33138324	missense	probably benign	0.07
IGL02028:Morc2b	APN	17	33137413	missense	possibly damaging	0.78
IGL02152:Morc2b	APN	17	33137943	missense	probably damaging	1.00
IGL02341:Morc2b	APN	17	33137307	missense	probably damaging	1.00
IGL02976:Morc2b	APN	17	33137523	missense	possibly damaging	0.90
IGL03293:Morc2b	APN	17	33138363	missense	probably damaging	1.00
twinkle	UTSW	17	33135932	nonsense	probably null
PIT4283001:Morc2b	UTSW	17	33136068	missense	probably benign	0.00
R0056:Morc2b	UTSW	17	33138759	missense	possibly damaging	0.78
R0116:Morc2b	UTSW	17	33137041	missense	probably damaging	1.00
R0179:Morc2b	UTSW	17	33136982	nonsense	probably null
R0533:Morc2b	UTSW	17	33135932	nonsense	probably null
R0556:Morc2b	UTSW	17	33137838	missense	probably benign	0.05
R0629:Morc2b	UTSW	17	33135807	missense	probably benign	0.00
R0635:Morc2b	UTSW	17	33137687	missense	possibly damaging	0.90
R1205:Morc2b	UTSW	17	33135934	missense	probably damaging	1.00
R1566:Morc2b	UTSW	17	33136974	missense	probably benign	0.02
R1676:Morc2b	UTSW	17	33135981	missense	possibly damaging	0.82
R1892:Morc2b	UTSW	17	33135774	missense	probably damaging	1.00
R1954:Morc2b	UTSW	17	33137490	missense	probably damaging	1.00
R1955:Morc2b	UTSW	17	33137490	missense	probably damaging	1.00
R1969:Morc2b	UTSW	17	33137091	missense	probably benign	0.00
R2069:Morc2b	UTSW	17	33136760	missense	probably benign	0.13
R3609:Morc2b	UTSW	17	33136278	missense	probably damaging	1.00
R3610:Morc2b	UTSW	17	33136278	missense	probably damaging	1.00
R3831:Morc2b	UTSW	17	33137259	missense	probably benign	0.01
R4156:Morc2b	UTSW	17	33138427	missense	probably benign	0.43
R4243:Morc2b	UTSW	17	33136401	missense	probably benign	0.03
R4877:Morc2b	UTSW	17	33138738	missense	probably benign	0.26
R4911:Morc2b	UTSW	17	33137377	missense	probably damaging	1.00
R5230:Morc2b	UTSW	17	33136252	missense	probably benign	0.00
R5264:Morc2b	UTSW	17	33138379	missense	probably benign	0.03
R5326:Morc2b	UTSW	17	33136933	missense	probably benign	0.01
R5455:Morc2b	UTSW	17	33138610	missense	probably benign	0.29
R5933:Morc2b	UTSW	17	33138609	missense	possibly damaging	0.84
R5973:Morc2b	UTSW	17	33137472	missense	probably damaging	0.97
R6026:Morc2b	UTSW	17	33137983	missense	possibly damaging	0.55
R6113:Morc2b	UTSW	17	33138068	nonsense	probably null
R6393:Morc2b	UTSW	17	33137776	missense	probably damaging	0.97
R7066:Morc2b	UTSW	17	33136636	missense	probably benign	0.00
R7117:Morc2b	UTSW	17	33137952	missense	probably benign	0.00
R7120:Morc2b	UTSW	17	33135813	missense	probably damaging	1.00
R7130:Morc2b	UTSW	17	33136288	missense	possibly damaging	0.68
R7498:Morc2b	UTSW	17	33137859	missense	possibly damaging	0.55
R7516:Morc2b	UTSW	17	33137461	missense	probably benign	0.03
R7664:Morc2b	UTSW	17	33136402	missense	probably benign	0.12
R7754:Morc2b	UTSW	17	33137244	missense	probably benign	0.33
R7756:Morc2b	UTSW	17	33137007	missense	probably damaging	1.00
R7758:Morc2b	UTSW	17	33137007	missense	probably damaging	1.00
R7766:Morc2b	UTSW	17	33138423	missense	probably benign	0.19
R7957:Morc2b	UTSW	17	33135773	missense	probably benign	0.39
R7965:Morc2b	UTSW	17	33135772	missense	possibly damaging	0.91
R8164:Morc2b	UTSW	17	33138040	missense	probably damaging	0.99
R8283:Morc2b	UTSW	17	33136701	missense	probably benign	0.00
R8338:Morc2b	UTSW	17	33136413	missense	probably benign
R8349:Morc2b	UTSW	17	33136801	missense	probably benign	0.13
R8352:Morc2b	UTSW	17	33137502	missense	probably damaging	1.00
R8362:Morc2b	UTSW	17	33138321	missense	possibly damaging	0.91
R8364:Morc2b	UTSW	17	33138240	missense	probably benign	0.01
R8449:Morc2b	UTSW	17	33136801	missense	probably benign	0.13
R8452:Morc2b	UTSW	17	33137502	missense	probably damaging	1.00
R8476:Morc2b	UTSW	17	33135859	missense	possibly damaging	0.87
Z1088:Morc2b	UTSW	17	33136086	missense	possibly damaging	0.49
Z1177:Morc2b	UTSW	17	33137402	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATGTTTATGCCCTGCTGAGCC -3'
(R):5'- TCTCCAGAGTACCAGAGCACTGATG -3'

Sequencing Primer
(F):5'- CAGCACATCTTTGGTAGGAGC -3'
(R):5'- TACCAGAGCACTGATGAACAG -3'

Posted On

2013-10-16