Incidental Mutation 'R0840:Olfr129'
ID77144
Institutional Source Beutler Lab
Gene Symbol Olfr129
Ensembl Gene ENSMUSG00000081724
Gene Nameolfactory receptor 129
SynonymsGA_x6K02T2PSCP-2503741-2502776, MOR263-9
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38050857-38060079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38055572 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 7 (F7S)
Ref Sequence ENSEMBL: ENSMUSP00000113564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122318] [ENSMUST00000174675] [ENSMUST00000216476]
Predicted Effect probably benign
Transcript: ENSMUST00000122318
AA Change: F7S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113564
Gene: ENSMUSG00000081724
AA Change: F7S

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 4.6e-56 PFAM
Pfam:7TM_GPCR_Srsx 50 319 1.1e-5 PFAM
Pfam:7tm_1 56 305 3.2e-21 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133865
Gene: ENSMUSG00000060017

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216476
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Olfr129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr129 APN 17 38055590 start codon destroyed probably null 0.15
IGL02163:Olfr129 APN 17 38054750 missense probably benign 0.06
IGL02374:Olfr129 APN 17 38055521 missense probably damaging 1.00
R1774:Olfr129 UTSW 17 38055437 missense probably benign 0.00
R3720:Olfr129 UTSW 17 38055368 missense probably damaging 1.00
R3794:Olfr129 UTSW 17 38054895 missense probably damaging 1.00
R3840:Olfr129 UTSW 17 38055348 missense probably damaging 1.00
R4002:Olfr129 UTSW 17 38054988 missense probably damaging 1.00
R4273:Olfr129 UTSW 17 38055272 missense probably damaging 1.00
R4872:Olfr129 UTSW 17 38055576 missense probably benign
R5606:Olfr129 UTSW 17 38054802 missense probably damaging 0.98
R6309:Olfr129 UTSW 17 38055152 missense probably damaging 1.00
R7269:Olfr129 UTSW 17 38055551 missense probably damaging 1.00
R7450:Olfr129 UTSW 17 38055109 missense probably benign 0.00
R7829:Olfr129 UTSW 17 38055329 missense possibly damaging 0.64
R8103:Olfr129 UTSW 17 38055012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCTGCAACATCTTCGGTATGAC -3'
(R):5'- TGCCAGGACTGCAAGTTTCCAC -3'

Sequencing Primer
(F):5'- AAGTGTAGCCAATCTCCAGG -3'
(R):5'- GGTCAGTACACTTTGGAAAATCCC -3'
Posted On2013-10-16