Incidental Mutation 'R0841:Trp53rkb'
ID77150
Institutional Source Beutler Lab
Gene Symbol Trp53rkb
Ensembl Gene ENSMUSG00000042854
Gene Nametransformation related protein 53 regulating kinase B
SynonymsNori-2, 4933401B08Rik, Trp53rk, mNori-2p, PRPK, 5630401H01Rik
MMRRC Submission 039020-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R0841 (G1)
Quality Score92
Status Not validated
Chromosome2
Chromosomal Location166792531-166799505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 166795510 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 129 (C129R)
Ref Sequence ENSEMBL: ENSMUSP00000115353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065753] [ENSMUST00000151826]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051923
Predicted Effect probably benign
Transcript: ENSMUST00000065753
SMART Domains Protein: ENSMUSP00000066907
Gene: ENSMUSG00000042854

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 107 137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151826
AA Change: C129R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115353
Gene: ENSMUSG00000042854
AA Change: C129R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 189 1.1e-6 PFAM
Pfam:Pkinase 25 201 5.8e-9 PFAM
Pfam:Kdo 31 216 1.4e-13 PFAM
Pfam:RIO1 36 185 3.8e-10 PFAM
low complexity region 219 230 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Trp53rkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Trp53rkb APN 2 166795394 missense probably damaging 1.00
R0200:Trp53rkb UTSW 2 166795683 missense probably damaging 1.00
R1921:Trp53rkb UTSW 2 166795823 missense probably damaging 1.00
R2183:Trp53rkb UTSW 2 166793957 missense possibly damaging 0.52
R3116:Trp53rkb UTSW 2 166794089 intron probably benign
R3925:Trp53rkb UTSW 2 166795472 missense probably damaging 1.00
R3977:Trp53rkb UTSW 2 166795526 missense possibly damaging 0.65
R4191:Trp53rkb UTSW 2 166795475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAGATGCGCTCCCTAACCACG -3'
(R):5'- AGCACTGGACTGGACTTCTTGGAC -3'

Sequencing Primer
(F):5'- ACGTGTGTCCATTGCAGG -3'
(R):5'- TTCTCCAGGACATAGAGGTCG -3'
Posted On2013-10-16