Incidental Mutation 'R0841:2310002L09Rik'
ID 77154
Institutional Source Beutler Lab
Gene Symbol 2310002L09Rik
Ensembl Gene ENSMUSG00000028396
Gene Name RIKEN cDNA 2310002L09 gene
Synonyms
MMRRC Submission 039020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R0841 (G1)
Quality Score 222
Status Validated
Chromosome 4
Chromosomal Location 73939371-73950846 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 73942749 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 205 (M205L)
Ref Sequence ENSEMBL: ENSMUSP00000092633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030101] [ENSMUST00000095023]
AlphaFold Q9D7L5
Predicted Effect probably benign
Transcript: ENSMUST00000030101
SMART Domains Protein: ENSMUSP00000030101
Gene: ENSMUSG00000028396

DomainStartEndE-ValueType
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095023
AA Change: M205L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092633
Gene: ENSMUSG00000028396
AA Change: M205L

DomainStartEndE-ValueType
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149981
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in 2310002L09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:2310002L09Rik APN 4 73942719 missense possibly damaging 0.66
IGL01366:2310002L09Rik APN 4 73950700 utr 5 prime probably benign
IGL02596:2310002L09Rik APN 4 73950667 missense possibly damaging 0.94
R2919:2310002L09Rik UTSW 4 73950608 missense probably damaging 1.00
R6056:2310002L09Rik UTSW 4 73942878 missense probably benign 0.00
R6795:2310002L09Rik UTSW 4 73950828 start gained probably benign
R6889:2310002L09Rik UTSW 4 73943053 missense probably benign 0.19
R7709:2310002L09Rik UTSW 4 73942854 missense possibly damaging 0.52
R7793:2310002L09Rik UTSW 4 73942935 missense probably benign 0.05
R8517:2310002L09Rik UTSW 4 73942969 missense probably damaging 1.00
R8671:2310002L09Rik UTSW 4 73942929 missense probably damaging 1.00
R8867:2310002L09Rik UTSW 4 73942850 missense probably damaging 1.00
R8938:2310002L09Rik UTSW 4 73943187 missense probably damaging 1.00
R9618:2310002L09Rik UTSW 4 73950697 start codon destroyed probably null 0.46
Predicted Primers PCR Primer
(F):5'- ACAAAATTCAATGGGGCTTTTCCTTGC -3'
(R):5'- TGTCATGGAGCTATTCCATCCTGACC -3'

Sequencing Primer
(F):5'- GAAAAGTATTCTCTTGGACTGTGAC -3'
(R):5'- AACCCTCTGGTCAAGCGTT -3'
Posted On 2013-10-16