Incidental Mutation 'R0841:Ldb2'
ID77157
Institutional Source Beutler Lab
Gene Symbol Ldb2
Ensembl Gene ENSMUSG00000039706
Gene NameLIM domain binding 2
SynonymsCLIM1, CLP-36, Ldb3, CLIM-1b, CLIM-1a
MMRRC Submission 039020-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0841 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location44472132-44799680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44532674 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 201 (L201P)
Ref Sequence ENSEMBL: ENSMUSP00000143289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070748] [ENSMUST00000199256] [ENSMUST00000199261] [ENSMUST00000199534]
Predicted Effect probably damaging
Transcript: ENSMUST00000070748
AA Change: L201P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067737
Gene: ENSMUSG00000039706
AA Change: L201P

DomainStartEndE-ValueType
Pfam:LIM_bind 30 232 9.9e-56 PFAM
low complexity region 249 281 N/A INTRINSIC
PDB:2JTN|A 293 337 2e-21 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198356
Predicted Effect probably damaging
Transcript: ENSMUST00000199256
AA Change: L201P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143775
Gene: ENSMUSG00000039706
AA Change: L201P

DomainStartEndE-ValueType
Pfam:LIM_bind 30 232 6.9e-56 PFAM
low complexity region 249 281 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199261
AA Change: L201P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143289
Gene: ENSMUSG00000039706
AA Change: L201P

DomainStartEndE-ValueType
Pfam:LIM_bind 29 233 2.3e-68 PFAM
low complexity region 249 281 N/A INTRINSIC
PDB:2YPA|D 296 335 2e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199471
Predicted Effect probably damaging
Transcript: ENSMUST00000199534
AA Change: L201P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142442
Gene: ENSMUSG00000039706
AA Change: L201P

DomainStartEndE-ValueType
Pfam:LIM_bind 29 233 2e-71 PFAM
low complexity region 249 281 N/A INTRINSIC
Meta Mutation Damage Score 0.9245 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the LIM-domain binding family. Members of this family are characterized by a conserved nuclear localization sequence, an amino-terminal homodimerization domain and a carboxy-terminal LIM interaction domain. These proteins function as adapter molecules to allow assembly of transcriptional regulatory complexes. Genetic association studies suggest functions for this gene in rhegmatogenous retinal detachment and coronary artery disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Ldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Ldb2 APN 5 44541684 splice site probably null
IGL01757:Ldb2 APN 5 44541867 splice site probably benign
IGL01936:Ldb2 APN 5 44480244 missense probably damaging 1.00
IGL03105:Ldb2 APN 5 44799373 missense possibly damaging 0.70
IGL03108:Ldb2 APN 5 44541715 missense probably damaging 1.00
R0152:Ldb2 UTSW 5 44541799 missense possibly damaging 0.86
R0178:Ldb2 UTSW 5 44473499 missense probably damaging 1.00
R1145:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1145:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1318:Ldb2 UTSW 5 44535037 critical splice donor site probably null
R1607:Ldb2 UTSW 5 44473472 missense probably damaging 0.99
R2863:Ldb2 UTSW 5 44480324 missense probably damaging 0.99
R3803:Ldb2 UTSW 5 44473394 missense probably benign 0.38
R4502:Ldb2 UTSW 5 44669407 missense probably damaging 1.00
R4613:Ldb2 UTSW 5 44476551 missense probably benign 0.27
R4985:Ldb2 UTSW 5 44480303 missense probably damaging 1.00
R5475:Ldb2 UTSW 5 44541832 missense probably damaging 1.00
R5512:Ldb2 UTSW 5 44480244 missense probably damaging 1.00
R6058:Ldb2 UTSW 5 44476563 missense possibly damaging 0.66
R6282:Ldb2 UTSW 5 44532665 missense probably damaging 1.00
R6438:Ldb2 UTSW 5 44480310 missense probably damaging 0.98
R6770:Ldb2 UTSW 5 44669396 missense probably damaging 0.99
R6830:Ldb2 UTSW 5 44541857 missense probably damaging 1.00
X0026:Ldb2 UTSW 5 44532728 missense probably damaging 0.99
X0028:Ldb2 UTSW 5 44541794 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ttgaagcCAGAACTTCTACTGcacc -3'
(R):5'- CATTTCAGCAGCAGCAACAGAGTC -3'

Sequencing Primer
(F):5'- acaaacacacaccacaccc -3'
(R):5'- ACAGAGTCTAGCACTTTCAGAAG -3'
Posted On2013-10-16