Incidental Mutation 'R0841:Olfr685'
ID77165
Institutional Source Beutler Lab
Gene Symbol Olfr685
Ensembl Gene ENSMUSG00000047794
Gene Nameolfactory receptor 685
SynonymsGA_x6K02T2PBJ9-7810071-7809121, MOR37-1
MMRRC Submission 039020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0841 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105178416-105186012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105180854 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 168 (V168E)
Ref Sequence ENSEMBL: ENSMUSP00000148994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051355] [ENSMUST00000209409] [ENSMUST00000214712] [ENSMUST00000217432]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051355
AA Change: V153E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061561
Gene: ENSMUSG00000047794
AA Change: V153E

DomainStartEndE-ValueType
Pfam:7tm_4 34 313 3e-107 PFAM
Pfam:7TM_GPCR_Srsx 38 217 2.9e-8 PFAM
Pfam:7tm_1 44 295 7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209409
AA Change: V168E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000214712
AA Change: V168E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217432
AA Change: V168E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.0228 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Olfr685
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Olfr685 APN 7 105180488 missense probably benign 0.00
IGL01612:Olfr685 APN 7 105180722 missense probably damaging 1.00
IGL02598:Olfr685 APN 7 105180956 missense probably damaging 1.00
R1164:Olfr685 UTSW 7 105180833 missense probably benign 0.02
R1711:Olfr685 UTSW 7 105180760 missense probably damaging 0.99
R1891:Olfr685 UTSW 7 105180547 nonsense probably null
R1901:Olfr685 UTSW 7 105180872 missense possibly damaging 0.88
R1990:Olfr685 UTSW 7 105181014 missense probably damaging 1.00
R3766:Olfr685 UTSW 7 105180881 missense probably damaging 0.98
R4750:Olfr685 UTSW 7 105180926 missense probably damaging 1.00
R5056:Olfr685 UTSW 7 105180572 missense probably damaging 1.00
R5061:Olfr685 UTSW 7 105180657 missense possibly damaging 0.56
R6227:Olfr685 UTSW 7 105180710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCACTGACAGACCATAAGCTC -3'
(R):5'- GCCATGCTTGCTGCTATTGACCTG -3'

Sequencing Primer
(F):5'- GACCATAAGCTCGATTCACTGTG -3'
(R):5'- GCCCATGAGATTGGGTACATTG -3'
Posted On2013-10-16