Incidental Mutation 'R0841:Kcnq1'
ID77169
Institutional Source Beutler Lab
Gene Symbol Kcnq1
Ensembl Gene ENSMUSG00000009545
Gene Namepotassium voltage-gated channel, subfamily Q, member 1
SynonymsKVLQT1, Kcna9
MMRRC Submission 039020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0841 (G1)
Quality Score174
Status Validated
Chromosome7
Chromosomal Location143106362-143427042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143107452 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 32 (K32E)
Ref Sequence ENSEMBL: ENSMUSP00000009689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009689] [ENSMUST00000185383] [ENSMUST00000186284] [ENSMUST00000186288] [ENSMUST00000186488] [ENSMUST00000186798] [ENSMUST00000187213]
Predicted Effect probably benign
Transcript: ENSMUST00000009689
AA Change: K32E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000009689
Gene: ENSMUSG00000009545
AA Change: K32E

DomainStartEndE-ValueType
Pfam:Ion_trans 121 358 7.5e-28 PFAM
Pfam:Ion_trans_2 261 351 5.9e-13 PFAM
low complexity region 404 427 N/A INTRINSIC
Pfam:KCNQ_channel 480 624 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185383
SMART Domains Protein: ENSMUSP00000139548
Gene: ENSMUSG00000009545

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Ion_trans 93 282 1.4e-23 PFAM
Pfam:Ion_trans_2 198 287 1.2e-11 PFAM
low complexity region 340 363 N/A INTRINSIC
low complexity region 422 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186284
Predicted Effect probably benign
Transcript: ENSMUST00000186288
Predicted Effect probably benign
Transcript: ENSMUST00000186488
SMART Domains Protein: ENSMUSP00000140673
Gene: ENSMUSG00000009545

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186798
Predicted Effect probably benign
Transcript: ENSMUST00000187213
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous targeted null or spontaneous mutants show circling and head-tossing behavior and are deaf with inner ear dysmorphology. Paternal inheritance of a deletion of an imprinted control region within an intron of this gene results in small body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Kcnq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Kcnq1 APN 7 143194278 nonsense probably null
IGL01936:Kcnq1 APN 7 143184504 missense possibly damaging 0.83
IGL02134:Kcnq1 APN 7 143183716 missense possibly damaging 0.66
IGL02613:Kcnq1 APN 7 143426126 unclassified probably benign
R1843:Kcnq1 UTSW 7 143183120 missense probably benign 0.03
R2571:Kcnq1 UTSW 7 143107696 missense probably benign 0.35
R2910:Kcnq1 UTSW 7 143425962 missense probably damaging 1.00
R3943:Kcnq1 UTSW 7 143426088 missense probably damaging 1.00
R4274:Kcnq1 UTSW 7 143184442 missense probably damaging 1.00
R4686:Kcnq1 UTSW 7 143107729 missense probably benign 0.44
R4795:Kcnq1 UTSW 7 143182757 missense probably benign 0.01
R5133:Kcnq1 UTSW 7 143194346 critical splice donor site probably null
R5151:Kcnq1 UTSW 7 143426012 missense probably benign
R5658:Kcnq1 UTSW 7 143363695 critical splice donor site probably null
R5732:Kcnq1 UTSW 7 143148756 intron probably benign
R5990:Kcnq1 UTSW 7 143261368 missense probably damaging 1.00
R6025:Kcnq1 UTSW 7 143106433 unclassified probably benign
R6111:Kcnq1 UTSW 7 143107737 missense probably benign 0.00
R6534:Kcnq1 UTSW 7 143194327 missense probably benign 0.16
R7196:Kcnq1 UTSW 7 143358741 missense possibly damaging 0.91
R7409:Kcnq1 UTSW 7 143109415 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGCTTGGCGGAGCAGGTAAC -3'
(R):5'- TGTAGACTCGGCCCTGGATGTG -3'

Sequencing Primer
(F):5'- GAGCAGGTAACCCGCTG -3'
(R):5'- CGCACTGTAGATGGAGACC -3'
Posted On2013-10-16