Incidental Mutation 'R0841:Slc43a2'
ID77176
Institutional Source Beutler Lab
Gene Symbol Slc43a2
Ensembl Gene ENSMUSG00000038178
Gene Namesolute carrier family 43, member 2
Synonyms7630402D21Rik
MMRRC Submission 039020-MU
Accession Numbers

Genbank: NM_001199283.1, NM_001199284.1, NM_173388.2; Ensembl: ENSMUST00000042561

Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #R0841 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75531694-75577575 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 75566989 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 363 (Y363*)
Ref Sequence ENSEMBL: ENSMUSP00000126838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042561] [ENSMUST00000108433] [ENSMUST00000169547]
Predicted Effect probably null
Transcript: ENSMUST00000042561
AA Change: Y363*
SMART Domains Protein: ENSMUSP00000046074
Gene: ENSMUSG00000038178
AA Change: Y363*

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.9e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108433
AA Change: Y363*
SMART Domains Protein: ENSMUSP00000104071
Gene: ENSMUSG00000038178
AA Change: Y363*

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.4e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155981
Predicted Effect probably null
Transcript: ENSMUST00000169547
AA Change: Y363*
SMART Domains Protein: ENSMUSP00000126838
Gene: ENSMUSG00000038178
AA Change: Y363*

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.4e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the L-amino acid transporter-3 or SLC43 family of transporters. The encoded protein mediates sodium-, chloride-, and pH-independent transport of L-isomers of neutral amino acids, including leucine, phenylalanine, valine and methionine. This protein may contribute to the transfer of amino acids across the placental membrane to the fetus. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display fetal growth retardation, abnormal placental amino acid transport, slow postnatal weight gain, malnutrition and postnatal lethality, likely as a result of impaired intestinal amino acid absorption. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Gene trapped(7)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Slc43a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Slc43a2 APN 11 75545751 splice site probably null
IGL03009:Slc43a2 APN 11 75572376 missense probably benign
IGL03145:Slc43a2 APN 11 75568437 missense probably benign 0.27
1mM(1):Slc43a2 UTSW 11 75566996 missense possibly damaging 0.80
R0051:Slc43a2 UTSW 11 75562850 missense probably damaging 1.00
R0051:Slc43a2 UTSW 11 75562850 missense probably damaging 1.00
R0133:Slc43a2 UTSW 11 75563577 missense probably benign 0.22
R0443:Slc43a2 UTSW 11 75544667 splice site probably benign
R1145:Slc43a2 UTSW 11 75566989 nonsense probably null
R1145:Slc43a2 UTSW 11 75566989 nonsense probably null
R1215:Slc43a2 UTSW 11 75562862 missense probably damaging 1.00
R1499:Slc43a2 UTSW 11 75562907 critical splice donor site probably null
R1943:Slc43a2 UTSW 11 75545741 splice site probably null
R2438:Slc43a2 UTSW 11 75563131 missense possibly damaging 0.90
R2512:Slc43a2 UTSW 11 75570577 missense probably damaging 1.00
R3726:Slc43a2 UTSW 11 75543154 splice site probably benign
R3804:Slc43a2 UTSW 11 75563598 missense probably benign 0.01
R4830:Slc43a2 UTSW 11 75543293 missense probably damaging 1.00
R5650:Slc43a2 UTSW 11 75545807 missense probably damaging 1.00
R6042:Slc43a2 UTSW 11 75570607 missense probably damaging 0.98
R6171:Slc43a2 UTSW 11 75563050 missense probably damaging 1.00
R6196:Slc43a2 UTSW 11 75568380 nonsense probably null
R6264:Slc43a2 UTSW 11 75567074 missense possibly damaging 0.90
R6597:Slc43a2 UTSW 11 75571855 missense probably damaging 1.00
R7681:Slc43a2 UTSW 11 75563673 missense probably benign 0.02
X0060:Slc43a2 UTSW 11 75532665 missense probably null 0.91
Predicted Primers PCR Primer
(F):5'- ACGTCTGAGTCTCTGGGAACAGTG -3'
(R):5'- CTGTCTTTCTCTGAGGGCTGCAAG -3'

Sequencing Primer
(F):5'- TAAAGCCCTGGTTATGGACACTG -3'
(R):5'- GCTGCAAGCAGGCTGTG -3'
Posted On2013-10-16