Incidental Mutation 'R0841:Tap2'
ID77186
Institutional Source Beutler Lab
Gene Symbol Tap2
Ensembl Gene ENSMUSG00000024339
Gene Nametransporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
SynonymsAbcb3, Ham-2, HAM2, Ham2, MTP2, PSF2, Tap-2
MMRRC Submission 039020-MU
Accession Numbers

Genbank: NM_011530; MGI: 98484

Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0841 (G1)
Quality Score161
Status Validated
Chromosome17
Chromosomal Location34203527-34216321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34215940 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 652 (D652E)
Ref Sequence ENSEMBL: ENSMUSP00000025197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025197] [ENSMUST00000121995]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025197
AA Change: D652E

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025197
Gene: ENSMUSG00000024339
AA Change: D652E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
Pfam:ABC_membrane 151 419 1.8e-62 PFAM
AAA 494 678 2.58e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121995
SMART Domains Protein: ENSMUSP00000112395
Gene: ENSMUSG00000081512

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127543
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with Tap1 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have no CD8+ T cells, although their numbers of CD4+ T cells and B cells are normal. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Chemically induced(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Tap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tap2 APN 17 34215378 missense probably benign 0.09
IGL00802:Tap2 APN 17 34209130 missense probably damaging 0.96
IGL01291:Tap2 APN 17 34209210 missense probably benign 0.01
IGL01337:Tap2 APN 17 34205412 unclassified probably benign
IGL01549:Tap2 APN 17 34214329 missense probably benign 0.12
IGL02433:Tap2 APN 17 34205419 unclassified probably benign
IGL02488:Tap2 APN 17 34214642 unclassified probably benign
IGL02657:Tap2 APN 17 34205458 missense probably damaging 0.99
IGL02677:Tap2 APN 17 34212047 missense probably benign 0.20
IGL03183:Tap2 APN 17 34205425 unclassified probably benign
date UTSW 17 34212354 missense probably damaging 0.99
date2 UTSW 17 34214032 nonsense probably null
ganymede UTSW 17 small insertion
hebe UTSW 17 small insertion
juventas UTSW 17 small insertion
palm UTSW 17 34215940 missense possibly damaging 0.64
3370:Tap2 UTSW 17 34209279 unclassified probably null
ANU05:Tap2 UTSW 17 34209210 missense probably benign 0.01
FR4976:Tap2 UTSW 17 34205699 unclassified probably benign
R0595:Tap2 UTSW 17 34212354 missense probably damaging 0.99
R1145:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1145:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1296:Tap2 UTSW 17 34211915 missense probably benign 0.12
R1567:Tap2 UTSW 17 34214091 missense probably benign 0.00
R1656:Tap2 UTSW 17 34205953 missense possibly damaging 0.64
R1693:Tap2 UTSW 17 34209212 missense probably benign 0.00
R2246:Tap2 UTSW 17 34208801 missense possibly damaging 0.82
R2251:Tap2 UTSW 17 34211954 missense probably damaging 0.98
R2937:Tap2 UTSW 17 34212354 missense possibly damaging 0.80
R4682:Tap2 UTSW 17 34214032 nonsense probably null
R5262:Tap2 UTSW 17 34214016 missense probably benign
R6052:Tap2 UTSW 17 34214709 missense probably damaging 1.00
R6151:Tap2 UTSW 17 34212047 missense probably benign 0.00
R6196:Tap2 UTSW 17 34214410 missense possibly damaging 0.50
R7020:Tap2 UTSW 17 34214414 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGATTGTGCCTTGCCTGTGTCC -3'
(R):5'- TCCAAAACGGTCCCAATCTTTATCCTG -3'

Sequencing Primer
(F):5'- CTCTCTCCAGGATGAAGAATGGTG -3'
(R):5'- CCACAGTCCTGAGAGGGG -3'
Posted On2013-10-16