Incidental Mutation 'R0842:Hhat'
ID77194
Institutional Source Beutler Lab
Gene Symbol Hhat
Ensembl Gene ENSMUSG00000037375
Gene Namehedgehog acyltransferase
Synonyms2810432O22Rik, Skn, AP-2CRE, Tg(TFAP2A-cre)1Will
MMRRC Submission 039021-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0842 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location192496711-192771223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 192726331 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 164 (N164S)
Ref Sequence ENSEMBL: ENSMUSP00000141575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044190] [ENSMUST00000128619] [ENSMUST00000192585]
Predicted Effect probably benign
Transcript: ENSMUST00000044190
AA Change: N164S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000046686
Gene: ENSMUSG00000037375
AA Change: N164S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 5.7e-51 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128619
AA Change: N164S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000120479
Gene: ENSMUSG00000037375
AA Change: N164S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 3.1e-60 PFAM
transmembrane domain 475 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154755
Predicted Effect probably benign
Transcript: ENSMUST00000192585
AA Change: N164S

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141575
Gene: ENSMUSG00000037375
AA Change: N164S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 2.4e-51 PFAM
transmembrane domain 475 497 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 'Skinny hedgehog' (SKI1) encodes an enzyme that acts within the secretory pathway to catalyze amino-terminal palmitoylation of 'hedgehog' (see MIM 600725).[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygous null mice display neonatal lethality, holoprosencephaly, short-limb dwarfism, and oligodactyly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
Apbb1ip G A 2: 22,867,666 R432Q possibly damaging Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggt6 T A 11: 72,437,262 L158* probably null Het
Gm281 G A 14: 13,856,686 S475L probably benign Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Morc3 T C 16: 93,873,396 probably null Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Pacsin2 T C 15: 83,379,181 E83G probably damaging Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Rab1b A T 19: 5,104,669 I84N probably damaging Het
Ric3 T C 7: 109,038,880 Y222C probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Socs4 T A 14: 47,289,969 H107Q probably damaging Het
Tex15 T A 8: 33,571,547 I335K possibly damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Zscan29 T A 2: 121,161,479 R609S possibly damaging Het
Other mutations in Hhat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Hhat APN 1 192717017 missense probably damaging 1.00
IGL02578:Hhat APN 1 192693913 missense probably damaging 0.98
R0420:Hhat UTSW 1 192552934 splice site probably null
R1794:Hhat UTSW 1 192693906 nonsense probably null
R1978:Hhat UTSW 1 192717107 missense probably benign 0.03
R2073:Hhat UTSW 1 192727379 missense possibly damaging 0.94
R2571:Hhat UTSW 1 192553022 missense probably damaging 1.00
R2891:Hhat UTSW 1 192595086 missense probably damaging 1.00
R4685:Hhat UTSW 1 192595054 missense probably damaging 1.00
R4781:Hhat UTSW 1 192686979 intron probably benign
R4988:Hhat UTSW 1 192657294 intron probably benign
R5002:Hhat UTSW 1 192543190 missense probably benign 0.23
R5018:Hhat UTSW 1 192595038 missense probably damaging 1.00
R5023:Hhat UTSW 1 192727339 missense probably damaging 1.00
R5695:Hhat UTSW 1 192717019 missense probably damaging 0.99
R6151:Hhat UTSW 1 192759757 missense probably damaging 1.00
R6239:Hhat UTSW 1 192595087 missense probably damaging 1.00
R7007:Hhat UTSW 1 192693826 missense possibly damaging 0.51
R7079:Hhat UTSW 1 192553046 missense possibly damaging 0.95
R7534:Hhat UTSW 1 192726304 missense probably damaging 1.00
Z1177:Hhat UTSW 1 192661492 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAGAAGACGTAGGTCAGCAGCCAC -3'
(R):5'- TAGGGTCTCCAACATGCAAGGCAC -3'

Sequencing Primer
(F):5'- TCAGCAGCCACGGGTAG -3'
(R):5'- gcaaggcacatgctcaac -3'
Posted On2013-10-16