Mutagenetix > Incidental Mutation

Incidental Mutation 'R0842:Fap'

77196

Institutional Source

Beutler Lab

Gene Symbol

Fap

Ensembl Gene

ENSMUSG00000000392

Gene Name

fibroblast activation protein

Synonyms

MMRRC Submission

039021-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0842 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62500943-62574075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62537001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 313 (W313R)

Ref Sequence

ENSEMBL: ENSMUSP00000000402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000174234] [ENSMUST00000174448]

AlphaFold

P97321

Predicted Effect

probably damaging
Transcript: ENSMUST00000000402
AA Change: W313R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: W313R

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:DPPIV_N	73	440	2e-110	PFAM
Pfam:Abhydrolase_5	504	719	2.4e-12	PFAM
Pfam:Abhydrolase_6	515	703	2.3e-10	PFAM
Pfam:Peptidase_S9	520	727	9.4e-60	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102732
AA Change: W346R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: W346R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	106	473	1.9e-106	PFAM
Pfam:Abhydrolase_5	537	752	2.9e-12	PFAM
Pfam:Peptidase_S9	553	760	1.5e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136297

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152085

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172676

Predicted Effect

probably damaging
Transcript: ENSMUST00000174234
AA Change: W321R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: W321R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	82	448	4.1e-108	PFAM
Pfam:Abhydrolase_5	512	727	6.4e-12	PFAM
Pfam:Abhydrolase_6	523	711	8.9e-10	PFAM
Pfam:Peptidase_S9	528	735	5.9e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000174448
AA Change: W341R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: W341R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	101	468	2.2e-110	PFAM
Pfam:Abhydrolase_5	532	747	2.5e-12	PFAM
Pfam:Abhydrolase_6	541	731	2.4e-10	PFAM
Pfam:Peptidase_S9	548	755	1e-59	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Angptl8	C	A	9: 21,835,676	Y53*	probably null	Het
Apbb1ip	G	A	2: 22,867,666	R432Q	possibly damaging	Het
BC005561	T	A	5: 104,519,200	N529K	possibly damaging	Het
Catsperb	A	T	12: 101,463,048	Q160L	probably damaging	Het
Cilp2	T	C	8: 69,883,118	Y410C	probably damaging	Het
Cntnap5a	G	A	1: 116,442,223	G857S	probably damaging	Het
Colca2	T	C	9: 51,272,368	E102G	probably benign	Het
D630045J12Rik	A	T	6: 38,148,465	V1538E	probably damaging	Het
Dnah7a	A	G	1: 53,501,674	S2514P	possibly damaging	Het
Eme1	C	T	11: 94,650,874	A41T	probably benign	Het
F11	T	C	8: 45,252,159	Y115C	probably damaging	Het
Fam155a	T	A	8: 9,770,114	D302V	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Ggt6	T	A	11: 72,437,262	L158*	probably null	Het
Gm281	G	A	14: 13,856,686	S475L	probably benign	Het
Herc2	A	C	7: 56,121,705	I1072L	probably benign	Het
Hhat	T	C	1: 192,726,331	N164S	probably benign	Het
Klrb1	A	G	6: 128,710,045		probably null	Het
L3mbtl4	T	A	17: 68,486,962	D320E	probably benign	Het
Lyst	C	A	13: 13,678,241	Y2275*	probably null	Het
Map4k3	T	C	17: 80,605,983	N611S	probably benign	Het
Morc3	T	C	16: 93,873,396		probably null	Het
Mtr	A	C	13: 12,200,247	Y864D	probably damaging	Het
Myh2	C	T	11: 67,179,524	A431V	possibly damaging	Het
Myo9a	C	A	9: 59,871,067	Q1369K	probably benign	Het
Nat3	T	C	8: 67,547,997	I176T	probably benign	Het
Ncapd3	C	T	9: 27,037,084	T54I	probably benign	Het
Nfyc	C	A	4: 120,759,377	E281D	probably benign	Het
Nlrp14	A	G	7: 107,183,135	D513G	probably benign	Het
Pacsin2	T	C	15: 83,379,181	E83G	probably damaging	Het
Plagl1	G	T	10: 13,128,554		probably benign	Het
Pmpcb	T	C	5: 21,748,774	L340P	possibly damaging	Het
Pou2f2	A	T	7: 25,096,930	L364Q	probably damaging	Het
Rab1b	A	T	19: 5,104,669	I84N	probably damaging	Het
Ric3	T	C	7: 109,038,880	Y222C	probably damaging	Het
Samhd1	A	G	2: 157,123,331	V188A	probably damaging	Het
Socs4	T	A	14: 47,289,969	H107Q	probably damaging	Het
Tex15	T	A	8: 33,571,547	I335K	possibly damaging	Het
Thop1	C	A	10: 81,075,577	T99K	probably damaging	Het
Tnik	A	G	3: 28,594,086	E429G	possibly damaging	Het
Vmn2r106	T	A	17: 20,268,203	I645F	probably damaging	Het
Zscan29	T	A	2: 121,161,479	R609S	possibly damaging	Het

Other mutations in Fap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Fap	APN	2	62524201	missense	possibly damaging	0.82
IGL01420:Fap	APN	2	62504502	splice site	probably benign
IGL01485:Fap	APN	2	62544311	missense	possibly damaging	0.80
IGL01987:Fap	APN	2	62528676	missense	probably damaging	1.00
IGL02198:Fap	APN	2	62554798	missense	probably benign
IGL02355:Fap	APN	2	62573498	missense	probably benign	0.02
IGL02362:Fap	APN	2	62573498	missense	probably benign	0.02
IGL03227:Fap	APN	2	62530763	critical splice acceptor site	probably null
IGL03266:Fap	APN	2	62537022	missense	probably benign
IGL03369:Fap	APN	2	62503355	splice site	probably benign
IGL03406:Fap	APN	2	62542122	splice site	probably benign
mnemosyne	UTSW	2	62528714	missense	probably damaging	1.00
R1467_Fap_571	UTSW	2	62517620	missense	probably benign	0.18
R4812_Fap_496	UTSW	2	62519021	missense	probably damaging	1.00
R5661_fap_070	UTSW	2	62536963	intron	probably benign
ANU74:Fap	UTSW	2	62547769	missense	probably damaging	1.00
R0254:Fap	UTSW	2	62503402	missense	probably damaging	1.00
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1591:Fap	UTSW	2	62553857	missense	probably damaging	0.99
R1671:Fap	UTSW	2	62553835	missense	possibly damaging	0.46
R1674:Fap	UTSW	2	62519005	missense	probably benign
R1795:Fap	UTSW	2	62548589	missense	probably damaging	1.00
R1869:Fap	UTSW	2	62528727	missense	probably damaging	1.00
R2032:Fap	UTSW	2	62542237	missense	probably benign	0.43
R2136:Fap	UTSW	2	62524207	missense	possibly damaging	0.94
R3546:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3547:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3771:Fap	UTSW	2	62533010	missense	probably damaging	1.00
R3801:Fap	UTSW	2	62546650	missense	probably benign	0.04
R3910:Fap	UTSW	2	62556104	missense	probably damaging	1.00
R4306:Fap	UTSW	2	62530707	critical splice donor site	probably null
R4323:Fap	UTSW	2	62503372	missense	probably damaging	0.97
R4517:Fap	UTSW	2	62530715	missense	probably benign	0.01
R4793:Fap	UTSW	2	62544369	missense	probably damaging	1.00
R4812:Fap	UTSW	2	62519021	missense	probably damaging	1.00
R4843:Fap	UTSW	2	62544374	missense	probably damaging	1.00
R5281:Fap	UTSW	2	62532961	critical splice donor site	probably null
R5661:Fap	UTSW	2	62536963	intron	probably benign
R5696:Fap	UTSW	2	62502459	missense	probably damaging	1.00
R5750:Fap	UTSW	2	62528714	missense	probably damaging	1.00
R5898:Fap	UTSW	2	62573503	missense	probably benign
R5907:Fap	UTSW	2	62544356	missense	probably damaging	1.00
R5944:Fap	UTSW	2	62542261	missense	probably damaging	1.00
R5991:Fap	UTSW	2	62518521	missense	probably damaging	1.00
R6110:Fap	UTSW	2	62554770	missense	possibly damaging	0.91
R6270:Fap	UTSW	2	62547788	missense	probably damaging	0.98
R6505:Fap	UTSW	2	62546603	nonsense	probably null
R6631:Fap	UTSW	2	62503381	missense	probably damaging	1.00
R6896:Fap	UTSW	2	62504600	nonsense	probably null
R7138:Fap	UTSW	2	62542178	missense	probably benign	0.10
R7806:Fap	UTSW	2	62503414	missense	probably damaging	1.00
R8000:Fap	UTSW	2	62502798	critical splice donor site	probably null
R8115:Fap	UTSW	2	62519041	missense	probably benign	0.07
R8737:Fap	UTSW	2	62512433	missense	probably benign	0.00
R8899:Fap	UTSW	2	62518473	missense	probably damaging	1.00
R8924:Fap	UTSW	2	62547821	missense	probably benign
R8972:Fap	UTSW	2	62548583	missense	probably benign	0.02
R8998:Fap	UTSW	2	62537024	missense	probably benign	0.12
R8999:Fap	UTSW	2	62537024	missense	probably benign	0.12
R9418:Fap	UTSW	2	62554837	nonsense	probably null
R9521:Fap	UTSW	2	62542156	missense	probably benign
R9686:Fap	UTSW	2	62573513	missense	possibly damaging	0.86
X0017:Fap	UTSW	2	62556180	missense	probably benign	0.04
X0026:Fap	UTSW	2	62512390	missense	probably damaging	1.00
Z1176:Fap	UTSW	2	62528774	missense	possibly damaging	0.87
Z1177:Fap	UTSW	2	62502446	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTACAGTGTGCCTAAATCTCAGCCC -3'
(R):5'- ACTGGAGGCTCAGTTGTAGAACACC -3'

Sequencing Primer
(F):5'- ACATGTGGCATTGTCCAGAC -3'
(R):5'- CATGGCCAGGCAGATTAACT -3'

Posted On

2013-10-16