Incidental Mutation 'R0842:Ric3'
ID77210
Institutional Source Beutler Lab
Gene Symbol Ric3
Ensembl Gene ENSMUSG00000048330
Gene NameRIC3 acetylcholine receptor chaperone
Synonyms
MMRRC Submission 039021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0842 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location109034312-109083331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109038880 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 222 (Y222C)
Ref Sequence ENSEMBL: ENSMUSP00000112788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000055993] [ENSMUST00000120876] [ENSMUST00000147580]
Predicted Effect probably benign
Transcript: ENSMUST00000033341
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055993
AA Change: Y223C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056990
Gene: ENSMUSG00000048330
AA Change: Y223C

DomainStartEndE-ValueType
Pfam:RIC3 15 165 1.2e-38 PFAM
low complexity region 256 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120876
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112788
Gene: ENSMUSG00000048330
AA Change: Y222C

DomainStartEndE-ValueType
Pfam:RIC3 15 165 3.9e-52 PFAM
low complexity region 255 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147580
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
Apbb1ip G A 2: 22,867,666 R432Q possibly damaging Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggt6 T A 11: 72,437,262 L158* probably null Het
Gm281 G A 14: 13,856,686 S475L probably benign Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Hhat T C 1: 192,726,331 N164S probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Morc3 T C 16: 93,873,396 probably null Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Pacsin2 T C 15: 83,379,181 E83G probably damaging Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Rab1b A T 19: 5,104,669 I84N probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Socs4 T A 14: 47,289,969 H107Q probably damaging Het
Tex15 T A 8: 33,571,547 I335K possibly damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Zscan29 T A 2: 121,161,479 R609S possibly damaging Het
Other mutations in Ric3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Ric3 APN 7 109054412 missense probably damaging 1.00
IGL00942:Ric3 APN 7 109054413 missense probably damaging 1.00
IGL02318:Ric3 APN 7 109048080 missense probably damaging 1.00
IGL02868:Ric3 APN 7 109054419 missense probably damaging 1.00
IGL03012:Ric3 APN 7 109038718 missense probably benign
R2291:Ric3 UTSW 7 109038883 missense probably damaging 1.00
R2912:Ric3 UTSW 7 109054453 missense possibly damaging 0.87
R2913:Ric3 UTSW 7 109054453 missense possibly damaging 0.87
R3690:Ric3 UTSW 7 109038610 missense possibly damaging 0.89
R4587:Ric3 UTSW 7 109054363 critical splice donor site probably null
R5039:Ric3 UTSW 7 109038723 missense probably benign
R5636:Ric3 UTSW 7 109038820 missense probably damaging 1.00
R6738:Ric3 UTSW 7 109048062 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACTGAAACCAGCATTCTCTGCC -3'
(R):5'- AGTCAGCCAGACTGCTCAGAATTTG -3'

Sequencing Primer
(F):5'- CACGGGGCAACAGAATTATCTTTC -3'
(R):5'- CCAGACTGCTCAGAATTTGTTCAAG -3'
Posted On2013-10-16