Mutagenetix > Incidental Mutation

Incidental Mutation 'R0842:Catsperb'

77228

Institutional Source

Beutler Lab

Gene Symbol

Catsperb

Ensembl Gene

ENSMUSG00000047014

Gene Name

cation channel sperm associated auxiliary subunit beta

Synonyms

4932415G16Rik

MMRRC Submission

039021-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R0842 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101404653-101626009 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101463048 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 160 (Q160L)

Ref Sequence

ENSEMBL: ENSMUSP00000052089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]

AlphaFold

A2RTF1

Predicted Effect

probably damaging
Transcript: ENSMUST00000055156
AA Change: Q160L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: Q160L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	73	95	N/A	INTRINSIC
Pfam:CATSPERB	569	1088	1.1e-258	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000221241
AA Change: Q160L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221965

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Angptl8	C	A	9: 21,835,676	Y53*	probably null	Het
Apbb1ip	G	A	2: 22,867,666	R432Q	possibly damaging	Het
BC005561	T	A	5: 104,519,200	N529K	possibly damaging	Het
Cilp2	T	C	8: 69,883,118	Y410C	probably damaging	Het
Cntnap5a	G	A	1: 116,442,223	G857S	probably damaging	Het
Colca2	T	C	9: 51,272,368	E102G	probably benign	Het
D630045J12Rik	A	T	6: 38,148,465	V1538E	probably damaging	Het
Dnah7a	A	G	1: 53,501,674	S2514P	possibly damaging	Het
Eme1	C	T	11: 94,650,874	A41T	probably benign	Het
F11	T	C	8: 45,252,159	Y115C	probably damaging	Het
Fam155a	T	A	8: 9,770,114	D302V	probably benign	Het
Fap	A	T	2: 62,537,001	W313R	probably damaging	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Ggt6	T	A	11: 72,437,262	L158*	probably null	Het
Gm281	G	A	14: 13,856,686	S475L	probably benign	Het
Herc2	A	C	7: 56,121,705	I1072L	probably benign	Het
Hhat	T	C	1: 192,726,331	N164S	probably benign	Het
Klrb1	A	G	6: 128,710,045		probably null	Het
L3mbtl4	T	A	17: 68,486,962	D320E	probably benign	Het
Lyst	C	A	13: 13,678,241	Y2275*	probably null	Het
Map4k3	T	C	17: 80,605,983	N611S	probably benign	Het
Morc3	T	C	16: 93,873,396		probably null	Het
Mtr	A	C	13: 12,200,247	Y864D	probably damaging	Het
Myh2	C	T	11: 67,179,524	A431V	possibly damaging	Het
Myo9a	C	A	9: 59,871,067	Q1369K	probably benign	Het
Nat3	T	C	8: 67,547,997	I176T	probably benign	Het
Ncapd3	C	T	9: 27,037,084	T54I	probably benign	Het
Nfyc	C	A	4: 120,759,377	E281D	probably benign	Het
Nlrp14	A	G	7: 107,183,135	D513G	probably benign	Het
Pacsin2	T	C	15: 83,379,181	E83G	probably damaging	Het
Plagl1	G	T	10: 13,128,554		probably benign	Het
Pmpcb	T	C	5: 21,748,774	L340P	possibly damaging	Het
Pou2f2	A	T	7: 25,096,930	L364Q	probably damaging	Het
Rab1b	A	T	19: 5,104,669	I84N	probably damaging	Het
Ric3	T	C	7: 109,038,880	Y222C	probably damaging	Het
Samhd1	A	G	2: 157,123,331	V188A	probably damaging	Het
Socs4	T	A	14: 47,289,969	H107Q	probably damaging	Het
Tex15	T	A	8: 33,571,547	I335K	possibly damaging	Het
Thop1	C	A	10: 81,075,577	T99K	probably damaging	Het
Tnik	A	G	3: 28,594,086	E429G	possibly damaging	Het
Vmn2r106	T	A	17: 20,268,203	I645F	probably damaging	Het
Zscan29	T	A	2: 121,161,479	R609S	possibly damaging	Het

Other mutations in Catsperb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00532:Catsperb	APN	12	101463119	missense	probably damaging	1.00
IGL00580:Catsperb	APN	12	101591529	missense	probably benign	0.01
IGL00661:Catsperb	APN	12	101588098	missense	probably damaging	1.00
IGL00979:Catsperb	APN	12	101415325	missense	probably benign	0.34
IGL01154:Catsperb	APN	12	101625681	missense	possibly damaging	0.79
IGL01360:Catsperb	APN	12	101625254	missense	probably damaging	1.00
IGL01607:Catsperb	APN	12	101480726	splice site	probably benign
IGL01679:Catsperb	APN	12	101591582	splice site	probably null
IGL01827:Catsperb	APN	12	101591540	missense	probably benign	0.00
IGL01866:Catsperb	APN	12	101509311	nonsense	probably null
IGL02161:Catsperb	APN	12	101409415	splice site	probably benign
IGL02177:Catsperb	APN	12	101541462	missense	probably damaging	1.00
IGL02618:Catsperb	APN	12	101480724	splice site	probably benign
IGL02721:Catsperb	APN	12	101625297	missense	probably null	1.00
IGL02828:Catsperb	APN	12	101480782	missense	probably benign	0.00
BB001:Catsperb	UTSW	12	101520565	missense	probably benign	0.02
BB011:Catsperb	UTSW	12	101520565	missense	probably benign	0.02
R0571:Catsperb	UTSW	12	101602774	missense	possibly damaging	0.72
R0727:Catsperb	UTSW	12	101594355	splice site	probably null
R1187:Catsperb	UTSW	12	101625732	missense	probably benign	0.07
R1432:Catsperb	UTSW	12	101622217	missense	probably damaging	1.00
R1449:Catsperb	UTSW	12	101588197	missense	probably benign	0.09
R1488:Catsperb	UTSW	12	101594267	missense	probably damaging	0.97
R1540:Catsperb	UTSW	12	101412330	missense	probably benign	0.02
R1560:Catsperb	UTSW	12	101625726	missense	probably benign	0.01
R1563:Catsperb	UTSW	12	101588102	missense	probably damaging	1.00
R1583:Catsperb	UTSW	12	101463114	missense	probably damaging	0.96
R1989:Catsperb	UTSW	12	101602711	missense	probably damaging	1.00
R1993:Catsperb	UTSW	12	101602767	missense	possibly damaging	0.86
R1995:Catsperb	UTSW	12	101602767	missense	possibly damaging	0.86
R2037:Catsperb	UTSW	12	101507962	missense	probably damaging	1.00
R2186:Catsperb	UTSW	12	101480782	missense	probably benign	0.00
R2217:Catsperb	UTSW	12	101594219	missense	probably damaging	0.99
R2391:Catsperb	UTSW	12	101624706	missense	probably damaging	1.00
R2679:Catsperb	UTSW	12	101463145	missense	probably damaging	1.00
R3848:Catsperb	UTSW	12	101509326	missense	probably damaging	0.98
R4023:Catsperb	UTSW	12	101602683	nonsense	probably null
R4507:Catsperb	UTSW	12	101480828	critical splice donor site	probably null
R4558:Catsperb	UTSW	12	101591540	missense	possibly damaging	0.94
R4649:Catsperb	UTSW	12	101541512	missense	probably benign	0.01
R4651:Catsperb	UTSW	12	101541512	missense	probably benign	0.01
R4866:Catsperb	UTSW	12	101507949	missense	probably damaging	1.00
R4873:Catsperb	UTSW	12	101587985	missense	possibly damaging	0.90
R4875:Catsperb	UTSW	12	101587985	missense	possibly damaging	0.90
R4897:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R5002:Catsperb	UTSW	12	101520554	missense	probably benign
R5137:Catsperb	UTSW	12	101549811	missense	probably damaging	0.96
R5396:Catsperb	UTSW	12	101594284	missense	possibly damaging	0.90
R5450:Catsperb	UTSW	12	101446068	missense	possibly damaging	0.92
R5484:Catsperb	UTSW	12	101575916	missense	probably benign	0.38
R5846:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R5905:Catsperb	UTSW	12	101602700	missense	possibly damaging	0.69
R5906:Catsperb	UTSW	12	101510462	missense	probably damaging	1.00
R6034:Catsperb	UTSW	12	101575832	missense	probably benign
R6034:Catsperb	UTSW	12	101575832	missense	probably benign
R6149:Catsperb	UTSW	12	101549839	missense	probably damaging	1.00
R6165:Catsperb	UTSW	12	101575816	missense	possibly damaging	0.90
R6210:Catsperb	UTSW	12	101412568	splice site	probably null
R6297:Catsperb	UTSW	12	101591396	splice site	probably null
R6302:Catsperb	UTSW	12	101588143	missense	possibly damaging	0.95
R6681:Catsperb	UTSW	12	101624735	nonsense	probably null
R6698:Catsperb	UTSW	12	101509207	missense	probably damaging	1.00
R6869:Catsperb	UTSW	12	101480737	missense	probably benign	0.09
R6948:Catsperb	UTSW	12	101481068	missense	probably benign	0.00
R7035:Catsperb	UTSW	12	101415334	missense	probably damaging	1.00
R7073:Catsperb	UTSW	12	101509238	missense	probably benign	0.09
R7100:Catsperb	UTSW	12	101446038	missense	possibly damaging	0.83
R7338:Catsperb	UTSW	12	101480984	missense	probably benign	0.08
R7397:Catsperb	UTSW	12	101588023	missense	possibly damaging	0.84
R7413:Catsperb	UTSW	12	101481048	missense	probably damaging	1.00
R7422:Catsperb	UTSW	12	101588034	missense	probably damaging	1.00
R7425:Catsperb	UTSW	12	101591498	missense	probably damaging	0.96
R7578:Catsperb	UTSW	12	101588285	missense	probably benign	0.01
R7924:Catsperb	UTSW	12	101520565	missense	probably benign	0.02
R8021:Catsperb	UTSW	12	101588063	missense	probably benign	0.22
R8060:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R8167:Catsperb	UTSW	12	101591455	missense	probably benign	0.00
R8323:Catsperb	UTSW	12	101409399	missense	probably benign	0.02
R8425:Catsperb	UTSW	12	101602769	missense	probably benign
R8547:Catsperb	UTSW	12	101446046	missense	probably damaging	1.00
R8671:Catsperb	UTSW	12	101594337	missense	possibly damaging	0.70
R8906:Catsperb	UTSW	12	101520645	missense	possibly damaging	0.92
R9227:Catsperb	UTSW	12	101549794	missense	probably benign
R9230:Catsperb	UTSW	12	101549794	missense	probably benign
R9298:Catsperb	UTSW	12	101594341	missense	possibly damaging	0.91
RF006:Catsperb	UTSW	12	101575979	critical splice donor site	probably null
Z1177:Catsperb	UTSW	12	101446048	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATGTGACCATGTATTTGCTGTGTTC -3'
(R):5'- CATGTGTGCTTCCACTTAAAACCATCC -3'

Sequencing Primer
(F):5'- ccaactgctgaactatctctcc -3'
(R):5'- TGCTTCCACTTAAAACCATCCTTAAC -3'

Posted On

2013-10-16