Incidental Mutation 'R0842:Catsperb'
ID 77228
Institutional Source Beutler Lab
Gene Symbol Catsperb
Ensembl Gene ENSMUSG00000047014
Gene Name cation channel sperm associated auxiliary subunit beta
Synonyms 4932415G16Rik
MMRRC Submission 039021-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R0842 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 101370912-101592268 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101429307 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 160 (Q160L)
Ref Sequence ENSEMBL: ENSMUSP00000052089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]
AlphaFold A2RTF1
Predicted Effect probably damaging
Transcript: ENSMUST00000055156
AA Change: Q160L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: Q160L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Pfam:CATSPERB 569 1088 1.1e-258 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221241
AA Change: Q160L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221965
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,746,972 (GRCm39) Y53* probably null Het
Apbb1ip G A 2: 22,757,678 (GRCm39) R432Q possibly damaging Het
Cdhr18 G A 14: 13,856,686 (GRCm38) S475L probably benign Het
Cilp2 T C 8: 70,335,768 (GRCm39) Y410C probably damaging Het
Cntnap5a G A 1: 116,369,953 (GRCm39) G857S probably damaging Het
D630045J12Rik A T 6: 38,125,400 (GRCm39) V1538E probably damaging Het
Dnah7a A G 1: 53,540,833 (GRCm39) S2514P possibly damaging Het
Eme1 C T 11: 94,541,700 (GRCm39) A41T probably benign Het
F11 T C 8: 45,705,196 (GRCm39) Y115C probably damaging Het
Fap A T 2: 62,367,345 (GRCm39) W313R probably damaging Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Ggt6 T A 11: 72,328,088 (GRCm39) L158* probably null Het
Herc2 A C 7: 55,771,453 (GRCm39) I1072L probably benign Het
Hhat T C 1: 192,408,639 (GRCm39) N164S probably benign Het
Klrb1 A G 6: 128,687,008 (GRCm39) probably null Het
L3mbtl4 T A 17: 68,793,957 (GRCm39) D320E probably benign Het
Lyst C A 13: 13,852,826 (GRCm39) Y2275* probably null Het
Map4k3 T C 17: 80,913,412 (GRCm39) N611S probably benign Het
Morc3 T C 16: 93,670,284 (GRCm39) probably null Het
Mtr A C 13: 12,215,133 (GRCm39) Y864D probably damaging Het
Myh2 C T 11: 67,070,350 (GRCm39) A431V possibly damaging Het
Myo9a C A 9: 59,778,350 (GRCm39) Q1369K probably benign Het
Nalf1 T A 8: 9,820,114 (GRCm39) D302V probably benign Het
Nat3 T C 8: 68,000,649 (GRCm39) I176T probably benign Het
Ncapd3 C T 9: 26,948,380 (GRCm39) T54I probably benign Het
Nfyc C A 4: 120,616,574 (GRCm39) E281D probably benign Het
Nlrp14 A G 7: 106,782,342 (GRCm39) D513G probably benign Het
Pacsin2 T C 15: 83,263,382 (GRCm39) E83G probably damaging Het
Plagl1 G T 10: 13,004,298 (GRCm39) probably benign Het
Pmpcb T C 5: 21,953,772 (GRCm39) L340P possibly damaging Het
Pou2af3 T C 9: 51,183,668 (GRCm39) E102G probably benign Het
Pou2f2 A T 7: 24,796,355 (GRCm39) L364Q probably damaging Het
Rab1b A T 19: 5,154,697 (GRCm39) I84N probably damaging Het
Ric3 T C 7: 108,638,087 (GRCm39) Y222C probably damaging Het
Samhd1 A G 2: 156,965,251 (GRCm39) V188A probably damaging Het
Socs4 T A 14: 47,527,426 (GRCm39) H107Q probably damaging Het
Tex15 T A 8: 34,061,575 (GRCm39) I335K possibly damaging Het
Thoc2l T A 5: 104,667,066 (GRCm39) N529K possibly damaging Het
Thop1 C A 10: 80,911,411 (GRCm39) T99K probably damaging Het
Tnik A G 3: 28,648,235 (GRCm39) E429G possibly damaging Het
Vmn2r106 T A 17: 20,488,465 (GRCm39) I645F probably damaging Het
Zscan29 T A 2: 120,991,960 (GRCm39) R609S possibly damaging Het
Other mutations in Catsperb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Catsperb APN 12 101,429,378 (GRCm39) missense probably damaging 1.00
IGL00580:Catsperb APN 12 101,557,788 (GRCm39) missense probably benign 0.01
IGL00661:Catsperb APN 12 101,554,357 (GRCm39) missense probably damaging 1.00
IGL00979:Catsperb APN 12 101,381,584 (GRCm39) missense probably benign 0.34
IGL01154:Catsperb APN 12 101,591,940 (GRCm39) missense possibly damaging 0.79
IGL01360:Catsperb APN 12 101,591,513 (GRCm39) missense probably damaging 1.00
IGL01607:Catsperb APN 12 101,446,985 (GRCm39) splice site probably benign
IGL01679:Catsperb APN 12 101,557,841 (GRCm39) splice site probably null
IGL01827:Catsperb APN 12 101,557,799 (GRCm39) missense probably benign 0.00
IGL01866:Catsperb APN 12 101,475,570 (GRCm39) nonsense probably null
IGL02161:Catsperb APN 12 101,375,674 (GRCm39) splice site probably benign
IGL02177:Catsperb APN 12 101,507,721 (GRCm39) missense probably damaging 1.00
IGL02618:Catsperb APN 12 101,446,983 (GRCm39) splice site probably benign
IGL02721:Catsperb APN 12 101,591,556 (GRCm39) missense probably null 1.00
IGL02828:Catsperb APN 12 101,447,041 (GRCm39) missense probably benign 0.00
BB001:Catsperb UTSW 12 101,486,824 (GRCm39) missense probably benign 0.02
BB011:Catsperb UTSW 12 101,486,824 (GRCm39) missense probably benign 0.02
R0571:Catsperb UTSW 12 101,569,033 (GRCm39) missense possibly damaging 0.72
R0727:Catsperb UTSW 12 101,560,614 (GRCm39) splice site probably null
R1187:Catsperb UTSW 12 101,591,991 (GRCm39) missense probably benign 0.07
R1432:Catsperb UTSW 12 101,588,476 (GRCm39) missense probably damaging 1.00
R1449:Catsperb UTSW 12 101,554,456 (GRCm39) missense probably benign 0.09
R1488:Catsperb UTSW 12 101,560,526 (GRCm39) missense probably damaging 0.97
R1540:Catsperb UTSW 12 101,378,589 (GRCm39) missense probably benign 0.02
R1560:Catsperb UTSW 12 101,591,985 (GRCm39) missense probably benign 0.01
R1563:Catsperb UTSW 12 101,554,361 (GRCm39) missense probably damaging 1.00
R1583:Catsperb UTSW 12 101,429,373 (GRCm39) missense probably damaging 0.96
R1989:Catsperb UTSW 12 101,568,970 (GRCm39) missense probably damaging 1.00
R1993:Catsperb UTSW 12 101,569,026 (GRCm39) missense possibly damaging 0.86
R1995:Catsperb UTSW 12 101,569,026 (GRCm39) missense possibly damaging 0.86
R2037:Catsperb UTSW 12 101,474,221 (GRCm39) missense probably damaging 1.00
R2186:Catsperb UTSW 12 101,447,041 (GRCm39) missense probably benign 0.00
R2217:Catsperb UTSW 12 101,560,478 (GRCm39) missense probably damaging 0.99
R2391:Catsperb UTSW 12 101,590,965 (GRCm39) missense probably damaging 1.00
R2679:Catsperb UTSW 12 101,429,404 (GRCm39) missense probably damaging 1.00
R3848:Catsperb UTSW 12 101,475,585 (GRCm39) missense probably damaging 0.98
R4023:Catsperb UTSW 12 101,568,942 (GRCm39) nonsense probably null
R4507:Catsperb UTSW 12 101,447,087 (GRCm39) critical splice donor site probably null
R4558:Catsperb UTSW 12 101,557,799 (GRCm39) missense possibly damaging 0.94
R4649:Catsperb UTSW 12 101,507,771 (GRCm39) missense probably benign 0.01
R4651:Catsperb UTSW 12 101,507,771 (GRCm39) missense probably benign 0.01
R4866:Catsperb UTSW 12 101,474,208 (GRCm39) missense probably damaging 1.00
R4873:Catsperb UTSW 12 101,554,244 (GRCm39) missense possibly damaging 0.90
R4875:Catsperb UTSW 12 101,554,244 (GRCm39) missense possibly damaging 0.90
R4897:Catsperb UTSW 12 101,569,025 (GRCm39) missense probably damaging 0.98
R5002:Catsperb UTSW 12 101,486,813 (GRCm39) missense probably benign
R5137:Catsperb UTSW 12 101,516,070 (GRCm39) missense probably damaging 0.96
R5396:Catsperb UTSW 12 101,560,543 (GRCm39) missense possibly damaging 0.90
R5450:Catsperb UTSW 12 101,412,327 (GRCm39) missense possibly damaging 0.92
R5484:Catsperb UTSW 12 101,542,175 (GRCm39) missense probably benign 0.38
R5846:Catsperb UTSW 12 101,569,025 (GRCm39) missense probably damaging 0.98
R5905:Catsperb UTSW 12 101,568,959 (GRCm39) missense possibly damaging 0.69
R5906:Catsperb UTSW 12 101,476,721 (GRCm39) missense probably damaging 1.00
R6034:Catsperb UTSW 12 101,542,091 (GRCm39) missense probably benign
R6034:Catsperb UTSW 12 101,542,091 (GRCm39) missense probably benign
R6149:Catsperb UTSW 12 101,516,098 (GRCm39) missense probably damaging 1.00
R6165:Catsperb UTSW 12 101,542,075 (GRCm39) missense possibly damaging 0.90
R6210:Catsperb UTSW 12 101,378,827 (GRCm39) splice site probably null
R6297:Catsperb UTSW 12 101,557,655 (GRCm39) splice site probably null
R6302:Catsperb UTSW 12 101,554,402 (GRCm39) missense possibly damaging 0.95
R6681:Catsperb UTSW 12 101,590,994 (GRCm39) nonsense probably null
R6698:Catsperb UTSW 12 101,475,466 (GRCm39) missense probably damaging 1.00
R6869:Catsperb UTSW 12 101,446,996 (GRCm39) missense probably benign 0.09
R6948:Catsperb UTSW 12 101,447,327 (GRCm39) missense probably benign 0.00
R7035:Catsperb UTSW 12 101,381,593 (GRCm39) missense probably damaging 1.00
R7073:Catsperb UTSW 12 101,475,497 (GRCm39) missense probably benign 0.09
R7100:Catsperb UTSW 12 101,412,297 (GRCm39) missense possibly damaging 0.83
R7338:Catsperb UTSW 12 101,447,243 (GRCm39) missense probably benign 0.08
R7397:Catsperb UTSW 12 101,554,282 (GRCm39) missense possibly damaging 0.84
R7413:Catsperb UTSW 12 101,447,307 (GRCm39) missense probably damaging 1.00
R7422:Catsperb UTSW 12 101,554,293 (GRCm39) missense probably damaging 1.00
R7425:Catsperb UTSW 12 101,557,757 (GRCm39) missense probably damaging 0.96
R7578:Catsperb UTSW 12 101,554,544 (GRCm39) missense probably benign 0.01
R7924:Catsperb UTSW 12 101,486,824 (GRCm39) missense probably benign 0.02
R8021:Catsperb UTSW 12 101,554,322 (GRCm39) missense probably benign 0.22
R8060:Catsperb UTSW 12 101,569,025 (GRCm39) missense probably damaging 0.98
R8167:Catsperb UTSW 12 101,557,714 (GRCm39) missense probably benign 0.00
R8323:Catsperb UTSW 12 101,375,658 (GRCm39) missense probably benign 0.02
R8425:Catsperb UTSW 12 101,569,028 (GRCm39) missense probably benign
R8547:Catsperb UTSW 12 101,412,305 (GRCm39) missense probably damaging 1.00
R8671:Catsperb UTSW 12 101,560,596 (GRCm39) missense possibly damaging 0.70
R8906:Catsperb UTSW 12 101,486,904 (GRCm39) missense possibly damaging 0.92
R9227:Catsperb UTSW 12 101,516,053 (GRCm39) missense probably benign
R9230:Catsperb UTSW 12 101,516,053 (GRCm39) missense probably benign
R9298:Catsperb UTSW 12 101,560,600 (GRCm39) missense possibly damaging 0.91
RF006:Catsperb UTSW 12 101,542,238 (GRCm39) critical splice donor site probably null
Z1177:Catsperb UTSW 12 101,412,307 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGTGACCATGTATTTGCTGTGTTC -3'
(R):5'- CATGTGTGCTTCCACTTAAAACCATCC -3'

Sequencing Primer
(F):5'- ccaactgctgaactatctctcc -3'
(R):5'- TGCTTCCACTTAAAACCATCCTTAAC -3'
Posted On 2013-10-16