Incidental Mutation 'R0842:Gm281'
ID77231
Institutional Source Beutler Lab
Gene Symbol Gm281
Ensembl Gene ENSMUSG00000084902
Gene Namepredicted gene 281
SynonymsLOC238939
MMRRC Submission 039021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0842 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location13814618-13914478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13856686 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 475 (S475L)
Ref Sequence ENSEMBL: ENSMUSP00000121887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144914]
Predicted Effect probably benign
Transcript: ENSMUST00000144914
AA Change: S475L

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121887
Gene: ENSMUSG00000084902
AA Change: S475L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 32 127 3.45e-2 SMART
CA 156 230 7.87e-9 SMART
CA 274 352 1.36e-3 SMART
CA 376 470 6.99e-3 SMART
CA 492 563 8.69e-11 SMART
CA 589 683 2.09e-1 SMART
transmembrane domain 705 727 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
Apbb1ip G A 2: 22,867,666 R432Q possibly damaging Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggt6 T A 11: 72,437,262 L158* probably null Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Hhat T C 1: 192,726,331 N164S probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Morc3 T C 16: 93,873,396 probably null Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Pacsin2 T C 15: 83,379,181 E83G probably damaging Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Rab1b A T 19: 5,104,669 I84N probably damaging Het
Ric3 T C 7: 109,038,880 Y222C probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Socs4 T A 14: 47,289,969 H107Q probably damaging Het
Tex15 T A 8: 33,571,547 I335K possibly damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Zscan29 T A 2: 121,161,479 R609S possibly damaging Het
Other mutations in Gm281
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0115:Gm281 UTSW 14 13899571 missense probably damaging 0.99
R1252:Gm281 UTSW 14 13862444 missense probably benign 0.00
R1275:Gm281 UTSW 14 13896949 missense probably damaging 1.00
R1631:Gm281 UTSW 14 13829796 missense probably damaging 0.99
R1831:Gm281 UTSW 14 13899619 missense probably damaging 1.00
R1885:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1886:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1887:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1903:Gm281 UTSW 14 13829657 missense possibly damaging 0.94
R1940:Gm281 UTSW 14 13828582 missense probably null 0.95
R2324:Gm281 UTSW 14 13868077 missense probably damaging 1.00
R3923:Gm281 UTSW 14 13865990 nonsense probably null
R4193:Gm281 UTSW 14 13914416 missense probably benign 0.02
R4195:Gm281 UTSW 14 13829772 missense probably benign 0.05
R4370:Gm281 UTSW 14 13862375 missense probably benign 0.03
R4675:Gm281 UTSW 14 13856724 missense probably benign 0.32
R4734:Gm281 UTSW 14 13845292 missense probably benign 0.13
R5387:Gm281 UTSW 14 13914438 start codon destroyed probably null 0.82
R6037:Gm281 UTSW 14 13864282 missense probably damaging 1.00
R6037:Gm281 UTSW 14 13864282 missense probably damaging 1.00
R6177:Gm281 UTSW 14 13868002 missense probably benign 0.08
R7051:Gm281 UTSW 14 13828486 missense
R7205:Gm281 UTSW 14 13866032 missense
R7258:Gm281 UTSW 14 13899648 missense
R7833:Gm281 UTSW 14 13896968 splice site probably null
R7916:Gm281 UTSW 14 13896968 splice site probably null
Z1177:Gm281 UTSW 14 13823754 missense
Z1177:Gm281 UTSW 14 13845421 missense
Predicted Primers PCR Primer
(F):5'- GAGCATTGCCAGTAAAGAGAAACTCCT -3'
(R):5'- TGTGGAAACACCAATCATTTGGAGGT -3'

Sequencing Primer
(F):5'- TCTGAAGGTGTTATGTCCAACCAC -3'
(R):5'- aacacCAATCATTTGGAGGTAGAAAG -3'
Posted On2013-10-16