Incidental Mutation 'R0842:Socs4'
ID77232
Institutional Source Beutler Lab
Gene Symbol Socs4
Ensembl Gene ENSMUSG00000048379
Gene Namesuppressor of cytokine signaling 4
SynonymsSocs7
MMRRC Submission 039021-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R0842 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47276931-47296102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47289969 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 107 (H107Q)
Ref Sequence ENSEMBL: ENSMUSP00000154000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065562] [ENSMUST00000227413]
Predicted Effect probably damaging
Transcript: ENSMUST00000065562
AA Change: H120Q

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066031
Gene: ENSMUSG00000048379
AA Change: H120Q

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
Pfam:SOCS 55 108 6.8e-23 PFAM
low complexity region 219 232 N/A INTRINSIC
SH2 281 367 1.11e-16 SMART
SOCS 377 420 1.69e-16 SMART
SOCS_box 383 419 1.13e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227413
AA Change: H107Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS), also known as STAT-induced STAT inhibitor (SSI), protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
Apbb1ip G A 2: 22,867,666 R432Q possibly damaging Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggt6 T A 11: 72,437,262 L158* probably null Het
Gm281 G A 14: 13,856,686 S475L probably benign Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Hhat T C 1: 192,726,331 N164S probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Morc3 T C 16: 93,873,396 probably null Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Pacsin2 T C 15: 83,379,181 E83G probably damaging Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Rab1b A T 19: 5,104,669 I84N probably damaging Het
Ric3 T C 7: 109,038,880 Y222C probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Tex15 T A 8: 33,571,547 I335K possibly damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Zscan29 T A 2: 121,161,479 R609S possibly damaging Het
Other mutations in Socs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Socs4 APN 14 47290252 missense probably benign
IGL01942:Socs4 APN 14 47290650 nonsense probably null
IGL02039:Socs4 APN 14 47290193 missense probably benign
IGL02117:Socs4 APN 14 47290807 missense probably damaging 1.00
R0281:Socs4 UTSW 14 47289868 missense probably benign 0.25
R0703:Socs4 UTSW 14 47290048 missense probably damaging 1.00
R0763:Socs4 UTSW 14 47290655 missense probably damaging 1.00
R1133:Socs4 UTSW 14 47290194 missense probably benign 0.01
R1280:Socs4 UTSW 14 47290913 missense probably benign 0.23
R1619:Socs4 UTSW 14 47290283 missense possibly damaging 0.87
R1632:Socs4 UTSW 14 47289577 start gained probably benign
R5058:Socs4 UTSW 14 47290132 nonsense probably null
R6008:Socs4 UTSW 14 47290161 missense probably damaging 0.98
R6648:Socs4 UTSW 14 47290176 missense probably benign 0.02
R6925:Socs4 UTSW 14 47289738 nonsense probably null
R7408:Socs4 UTSW 14 47289839 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCGTCCAGAAAGTGCCCAGAAG -3'
(R):5'- CCACCTGTACACGAAGCACTGTTG -3'

Sequencing Primer
(F):5'- CTGAATCTGAAGCCATAGGTACTG -3'
(R):5'- GTGAGAAACAGGGTATGTCATCTTC -3'
Posted On2013-10-16