Incidental Mutation 'R0842:Pacsin2'
ID77233
Institutional Source Beutler Lab
Gene Symbol Pacsin2
Ensembl Gene ENSMUSG00000016664
Gene Nameprotein kinase C and casein kinase substrate in neurons 2
SynonymsSyndapin II
MMRRC Submission 039021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0842 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location83375607-83464606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83379181 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 83 (E83G)
Ref Sequence ENSEMBL: ENSMUSP00000155925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056177] [ENSMUST00000165095] [ENSMUST00000171436] [ENSMUST00000230679] [ENSMUST00000231184] [ENSMUST00000231946]
Predicted Effect probably damaging
Transcript: ENSMUST00000056177
AA Change: E389G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058320
Gene: ENSMUSG00000016664
AA Change: E389G

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165095
AA Change: E389G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130098
Gene: ENSMUSG00000016664
AA Change: E389G

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171436
AA Change: E389G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131504
Gene: ENSMUSG00000016664
AA Change: E389G

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000230030
AA Change: E174G
Predicted Effect probably damaging
Transcript: ENSMUST00000230679
AA Change: E389G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231043
Predicted Effect probably damaging
Transcript: ENSMUST00000231184
AA Change: E389G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000231946
AA Change: E83G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation by regulating tubulin polymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
Apbb1ip G A 2: 22,867,666 R432Q possibly damaging Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggt6 T A 11: 72,437,262 L158* probably null Het
Gm281 G A 14: 13,856,686 S475L probably benign Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Hhat T C 1: 192,726,331 N164S probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Morc3 T C 16: 93,873,396 probably null Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Rab1b A T 19: 5,104,669 I84N probably damaging Het
Ric3 T C 7: 109,038,880 Y222C probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Socs4 T A 14: 47,289,969 H107Q probably damaging Het
Tex15 T A 8: 33,571,547 I335K possibly damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Zscan29 T A 2: 121,161,479 R609S possibly damaging Het
Other mutations in Pacsin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Pacsin2 APN 15 83386686 missense probably damaging 1.00
IGL02574:Pacsin2 APN 15 83388663 missense possibly damaging 0.81
R0153:Pacsin2 UTSW 15 83377661 missense probably benign 0.11
R0399:Pacsin2 UTSW 15 83386782 missense probably damaging 1.00
R0426:Pacsin2 UTSW 15 83379795 missense possibly damaging 0.90
R0799:Pacsin2 UTSW 15 83379797 missense probably benign 0.44
R1591:Pacsin2 UTSW 15 83385051 missense probably damaging 1.00
R2406:Pacsin2 UTSW 15 83385112 unclassified probably benign
R3906:Pacsin2 UTSW 15 83379055 missense probably damaging 1.00
R4686:Pacsin2 UTSW 15 83381775 missense probably benign 0.01
R4815:Pacsin2 UTSW 15 83385059 missense probably damaging 1.00
R5849:Pacsin2 UTSW 15 83390518 missense possibly damaging 0.87
R6010:Pacsin2 UTSW 15 83381819 missense possibly damaging 0.87
R6152:Pacsin2 UTSW 15 83377699 missense probably damaging 1.00
R6367:Pacsin2 UTSW 15 83381832 missense probably benign
R6457:Pacsin2 UTSW 15 83379678 splice site probably null
R7158:Pacsin2 UTSW 15 83379742 missense possibly damaging 0.50
R7220:Pacsin2 UTSW 15 83385059 missense probably damaging 1.00
X0027:Pacsin2 UTSW 15 83392602 missense probably benign 0.06
Z1177:Pacsin2 UTSW 15 83402001 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCAGCCTTGAAGCTCAGCTCATC -3'
(R):5'- GGCACAGCTAACACTCTTCAGTTGC -3'

Sequencing Primer
(F):5'- GAAGCTCAGCTCATCATGTTC -3'
(R):5'- GCGTGGGTACAGCTCTATC -3'
Posted On2013-10-16