Incidental Mutation 'R0842:Morc3'
ID77234
Institutional Source Beutler Lab
Gene Symbol Morc3
Ensembl Gene ENSMUSG00000039456
Gene Namemicrorchidia 3
SynonymsZcwcc3, 1110051N18Rik, 1110051N18Rik, D16Jhu32e
MMRRC Submission 039021-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0842 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location93832121-93876073 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 93873396 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044068] [ENSMUST00000201097] [ENSMUST00000202261]
Predicted Effect probably null
Transcript: ENSMUST00000044068
SMART Domains Protein: ENSMUSP00000040152
Gene: ENSMUSG00000039456

DomainStartEndE-ValueType
Pfam:HATPase_c 25 130 8e-8 PFAM
Pfam:HATPase_c_3 26 164 1.1e-18 PFAM
Pfam:zf-CW 409 452 2.7e-19 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
coiled coil region 765 871 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201097
SMART Domains Protein: ENSMUSP00000144058
Gene: ENSMUSG00000039456

DomainStartEndE-ValueType
Blast:HATPase_c 1 70 4e-39 BLAST
Pfam:zf-CW 340 383 1.2e-16 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 557 566 N/A INTRINSIC
coiled coil region 692 798 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202261
SMART Domains Protein: ENSMUSP00000144369
Gene: ENSMUSG00000039456

DomainStartEndE-ValueType
Pfam:HATPase_c 25 130 8e-8 PFAM
Pfam:HATPase_c_3 26 164 1.1e-18 PFAM
Pfam:zf-CW 409 452 2.7e-19 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
coiled coil region 765 871 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232425
Predicted Effect probably benign
Transcript: ENSMUST00000232639
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the nuclear matrix and forms nuclear bodies via an ATP-dependent mechanism. The protein is predicted to have coiled-coil and zinc finger domains and has RNA binding activity. Alternative splicing produces multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele die at or within a day of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
Apbb1ip G A 2: 22,867,666 R432Q possibly damaging Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggt6 T A 11: 72,437,262 L158* probably null Het
Gm281 G A 14: 13,856,686 S475L probably benign Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Hhat T C 1: 192,726,331 N164S probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Pacsin2 T C 15: 83,379,181 E83G probably damaging Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Rab1b A T 19: 5,104,669 I84N probably damaging Het
Ric3 T C 7: 109,038,880 Y222C probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Socs4 T A 14: 47,289,969 H107Q probably damaging Het
Tex15 T A 8: 33,571,547 I335K possibly damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Zscan29 T A 2: 121,161,479 R609S possibly damaging Het
Other mutations in Morc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Morc3 APN 16 93873395 critical splice donor site probably null
IGL01015:Morc3 APN 16 93862646 missense probably damaging 1.00
IGL01374:Morc3 APN 16 93844213 missense probably damaging 1.00
IGL01634:Morc3 APN 16 93873237 missense probably benign 0.02
IGL01845:Morc3 APN 16 93860567 missense probably damaging 0.96
IGL02202:Morc3 APN 16 93870861 missense probably benign 0.01
IGL02478:Morc3 APN 16 93864956 splice site probably benign
IGL03026:Morc3 APN 16 93862724 splice site probably benign
IGL03115:Morc3 APN 16 93871083 missense probably damaging 0.99
Ballista UTSW 16 93841383 missense probably damaging 1.00
mindy UTSW 16 93866533 missense probably benign 0.03
Pfaff UTSW 16 93862684 missense probably damaging 0.96
shield UTSW 16 93874812 missense probably damaging 0.98
Stooges UTSW 16 93841387 missense probably damaging 1.00
Sword UTSW 16 93874757 critical splice acceptor site probably null
R0173:Morc3 UTSW 16 93832206 utr 5 prime probably null
R0413:Morc3 UTSW 16 93870474 missense probably damaging 1.00
R0639:Morc3 UTSW 16 93853850 missense probably damaging 1.00
R1134:Morc3 UTSW 16 93870669 missense probably benign
R1162:Morc3 UTSW 16 93853108 missense probably damaging 1.00
R1498:Morc3 UTSW 16 93853855 missense probably damaging 1.00
R1520:Morc3 UTSW 16 93844241 missense probably damaging 0.96
R1603:Morc3 UTSW 16 93866503 missense probably benign
R1622:Morc3 UTSW 16 93874806 missense probably benign 0.28
R1630:Morc3 UTSW 16 93866533 missense probably benign 0.03
R1818:Morc3 UTSW 16 93855510 missense probably damaging 1.00
R1902:Morc3 UTSW 16 93870497 missense probably damaging 1.00
R2090:Morc3 UTSW 16 93866453 missense probably benign 0.23
R2261:Morc3 UTSW 16 93853221 splice site probably benign
R2360:Morc3 UTSW 16 93841387 missense probably damaging 1.00
R2407:Morc3 UTSW 16 93844327 critical splice donor site probably null
R2519:Morc3 UTSW 16 93862539 splice site probably null
R3736:Morc3 UTSW 16 93874812 missense probably damaging 0.98
R3873:Morc3 UTSW 16 93862436 missense probably damaging 0.99
R4114:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4115:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4116:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4472:Morc3 UTSW 16 93874757 critical splice acceptor site probably null
R4609:Morc3 UTSW 16 93864968 missense probably benign 0.01
R4708:Morc3 UTSW 16 93873238 missense probably benign 0.19
R4883:Morc3 UTSW 16 93870362 critical splice acceptor site probably null
R4945:Morc3 UTSW 16 93871194 missense probably damaging 1.00
R4965:Morc3 UTSW 16 93860587 nonsense probably null
R5399:Morc3 UTSW 16 93862539 splice site probably null
R5481:Morc3 UTSW 16 93862655 missense probably damaging 0.99
R5540:Morc3 UTSW 16 93847380 missense probably benign
R5970:Morc3 UTSW 16 93866453 missense possibly damaging 0.65
R6006:Morc3 UTSW 16 93866493 missense possibly damaging 0.67
R6044:Morc3 UTSW 16 93866442 missense probably benign 0.02
R6045:Morc3 UTSW 16 93874845 missense probably damaging 1.00
R6155:Morc3 UTSW 16 93862425 missense possibly damaging 0.94
R6165:Morc3 UTSW 16 93841383 missense probably damaging 1.00
R6225:Morc3 UTSW 16 93845194 nonsense probably null
R6240:Morc3 UTSW 16 93862684 missense probably damaging 0.96
R6835:Morc3 UTSW 16 93847421 missense probably damaging 1.00
R6918:Morc3 UTSW 16 93853135 missense probably benign 0.36
R6944:Morc3 UTSW 16 93870572 missense probably benign
R7311:Morc3 UTSW 16 93849173 missense probably damaging 1.00
R7398:Morc3 UTSW 16 93874860 missense probably damaging 1.00
R7553:Morc3 UTSW 16 93870936 missense probably damaging 0.98
R8056:Morc3 UTSW 16 93845176 missense probably benign 0.07
X0023:Morc3 UTSW 16 93847399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCAATGTGTCTTGGAAGCCG -3'
(R):5'- GGCTTACGTTCCAGCATCCACATAG -3'

Sequencing Primer
(F):5'- CCGAAAACTTTATCAGGGTAGGTC -3'
(R):5'- Tacacacacacacacacacac -3'
Posted On2013-10-16