Incidental Mutation 'R0842:Rab1b'
ID77238
Institutional Source Beutler Lab
Gene Symbol Rab1b
Ensembl Gene ENSMUSG00000024870
Gene NameRAB1B, member RAS oncogene family
Synonyms
MMRRC Submission 039021-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R0842 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5099207-5106996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5104669 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 84 (I84N)
Ref Sequence ENSEMBL: ENSMUSP00000025804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025798] [ENSMUST00000025804] [ENSMUST00000113727] [ENSMUST00000113728] [ENSMUST00000116563]
Predicted Effect probably benign
Transcript: ENSMUST00000025798
SMART Domains Protein: ENSMUSP00000025798
Gene: ENSMUSG00000024862

DomainStartEndE-ValueType
Pfam:Rab5-bind 69 239 4.1e-64 PFAM
Pfam:TPR_10 197 238 9.5e-9 PFAM
TPR 240 273 6.19e-1 SMART
TPR 282 315 1.16e-5 SMART
TPR 324 357 2.16e0 SMART
TPR 366 399 1.6e-3 SMART
Pfam:TPR_10 448 483 1.5e-4 PFAM
low complexity region 496 507 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 592 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000025804
AA Change: I84N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025804
Gene: ENSMUSG00000024870
AA Change: I84N

DomainStartEndE-ValueType
RAB 9 172 4.57e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113727
SMART Domains Protein: ENSMUSP00000109356
Gene: ENSMUSG00000024862

DomainStartEndE-ValueType
Pfam:Rab5-bind 69 239 4.1e-64 PFAM
Pfam:TPR_10 197 238 9.5e-9 PFAM
TPR 240 273 6.19e-1 SMART
TPR 282 315 1.16e-5 SMART
TPR 324 357 2.16e0 SMART
TPR 366 399 1.6e-3 SMART
Pfam:TPR_10 448 483 1.5e-4 PFAM
low complexity region 496 507 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 592 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113728
SMART Domains Protein: ENSMUSP00000109357
Gene: ENSMUSG00000024862

DomainStartEndE-ValueType
Pfam:Rab5-bind 69 239 4.1e-64 PFAM
Pfam:TPR_10 197 238 9.5e-9 PFAM
TPR 240 273 6.19e-1 SMART
TPR 282 315 1.16e-5 SMART
TPR 324 357 2.16e0 SMART
TPR 366 399 1.6e-3 SMART
Pfam:TPR_10 448 483 1.5e-4 PFAM
low complexity region 496 507 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 592 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116563
SMART Domains Protein: ENSMUSP00000112262
Gene: ENSMUSG00000024862

DomainStartEndE-ValueType
coiled coil region 80 140 N/A INTRINSIC
Pfam:TPR_10 197 238 3.1e-9 PFAM
TPR 240 273 6.19e-1 SMART
TPR 282 315 1.16e-5 SMART
TPR 324 357 2.16e0 SMART
TPR 366 399 1.6e-3 SMART
low complexity region 416 428 N/A INTRINSIC
Pfam:TPR_10 450 486 1.1e-4 PFAM
low complexity region 498 509 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142255
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAB protein family, such as RAB1B, are low molecular mass monomeric GTPases localized on the cytoplasmic surfaces of distinct membrane-bound organelles. RAB1B functions in the early secretory pathway and is essential for vesicle transport between the endoplasmic reticulum (ER) and Golgi (Chen et al., 1997 [PubMed 9030196]; Alvarez et al., 2003 [PubMed 12802079]).[supplied by OMIM, Jan 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion do not exhibit a detectable mutant phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
Apbb1ip G A 2: 22,867,666 R432Q possibly damaging Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggt6 T A 11: 72,437,262 L158* probably null Het
Gm281 G A 14: 13,856,686 S475L probably benign Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Hhat T C 1: 192,726,331 N164S probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Morc3 T C 16: 93,873,396 probably null Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Pacsin2 T C 15: 83,379,181 E83G probably damaging Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Ric3 T C 7: 109,038,880 Y222C probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Socs4 T A 14: 47,289,969 H107Q probably damaging Het
Tex15 T A 8: 33,571,547 I335K possibly damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Zscan29 T A 2: 121,161,479 R609S possibly damaging Het
Other mutations in Rab1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Rab1b APN 19 5104934 unclassified probably benign
IGL03014:Rab1b UTSW 19 5104895 missense probably benign 0.20
R0594:Rab1b UTSW 19 5100656 unclassified probably benign
R1163:Rab1b UTSW 19 5104656 nonsense probably null
R1792:Rab1b UTSW 19 5100485 missense probably benign 0.02
R7231:Rab1b UTSW 19 5105201 missense probably damaging 0.98
R7636:Rab1b UTSW 19 5100782 missense probably damaging 1.00
R7895:Rab1b UTSW 19 5100496 missense probably benign
R7978:Rab1b UTSW 19 5100496 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAATTGCTCCTCGAATCTGGAGAC -3'
(R):5'- CCATTGAGCTGGACGGCAAAAC -3'

Sequencing Primer
(F):5'- GGTTCTATCAAGACTCCATGACAGG -3'
(R):5'- TGGACGGCAAAACCATCAAAC -3'
Posted On2013-10-16