Mutagenetix > Incidental Mutation

Incidental Mutation 'R0843:Ifi207'

77240

Institutional Source

Beutler Lab

Gene Symbol

Ifi207

Ensembl Gene

ENSMUSG00000073490

Gene Name

interferon activated gene 207

Synonyms

AI607873, Pyhin-A

MMRRC Submission

039022-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R0843 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

173550993-173569313 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 173555143 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 853 (N853K)

Ref Sequence

ENSEMBL: ENSMUSP00000048129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042610] [ENSMUST00000127730]

AlphaFold

E9Q3L4

Predicted Effect

probably damaging
Transcript: ENSMUST00000042610
AA Change: N853K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048129
Gene: ENSMUSG00000073490
AA Change: N853K

Domain	Start	End	E-Value	Type
PYRIN	6	84	3.2e-15	SMART
low complexity region	121	133	N/A	INTRINSIC
low complexity region	136	162	N/A	INTRINSIC
low complexity region	207	215	N/A	INTRINSIC
internal_repeat_1	286	472	4.17e-7	PROSPERO
low complexity region	476	496	N/A	INTRINSIC
internal_repeat_1	565	782	4.17e-7	PROSPERO
Pfam:HIN	788	954	4.9e-76	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000127730
AA Change: N846K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119350
Gene: ENSMUSG00000073490
AA Change: N846K

Domain	Start	End	E-Value	Type
PYRIN	6	84	3.2e-15	SMART
low complexity region	121	133	N/A	INTRINSIC
low complexity region	136	155	N/A	INTRINSIC
low complexity region	200	208	N/A	INTRINSIC
internal_repeat_1	279	465	6.41e-7	PROSPERO
low complexity region	469	489	N/A	INTRINSIC
internal_repeat_1	558	775	6.41e-7	PROSPERO
Pfam:HIN	781	948	1.8e-78	PFAM

Meta Mutation Damage Score

0.1804

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.5%
20x: 92.6%

Validation Efficiency

98% (40/41)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adrb2	T	C	18: 62,312,142 (GRCm39)	R228G	probably benign	Het
Arrdc3	T	C	13: 81,038,922 (GRCm39)		probably benign	Het
Cacna1d	T	C	14: 29,846,828 (GRCm39)	Y526C	probably damaging	Het
Cenpn	T	C	8: 117,660,045 (GRCm39)	V125A	probably benign	Het
Cyfip1	A	T	7: 55,572,568 (GRCm39)	H963L	probably benign	Het
Dnah8	T	C	17: 31,032,069 (GRCm39)	Y4130H	probably damaging	Het
Dnmt3a	T	C	12: 3,922,886 (GRCm39)		probably benign	Het
Dync1h1	C	T	12: 110,631,647 (GRCm39)	T4448M	possibly damaging	Het
Efr3a	T	A	15: 65,709,272 (GRCm39)		probably benign	Het
Fgf11	T	G	11: 69,689,602 (GRCm39)		probably benign	Het
Gabrr1	T	A	4: 33,161,717 (GRCm39)	I347N	possibly damaging	Het
Hsh2d	G	A	8: 72,954,304 (GRCm39)	D229N	probably benign	Het
Hspa1b	T	A	17: 35,176,524 (GRCm39)	N487I	possibly damaging	Het
Iqgap3	A	G	3: 88,015,738 (GRCm39)	D40G	possibly damaging	Het
Iyd	T	C	10: 3,495,663 (GRCm39)	V107A	possibly damaging	Het
Kctd3	A	T	1: 188,729,170 (GRCm39)	L129*	probably null	Het
Myo7b	A	G	18: 32,107,137 (GRCm39)	F1286S	possibly damaging	Het
Or4a47	C	T	2: 89,665,960 (GRCm39)	V110I	probably benign	Het
Or52s1b	T	A	7: 102,822,326 (GRCm39)	T173S	possibly damaging	Het
Or8c15	T	A	9: 38,120,579 (GRCm39)	F77I	possibly damaging	Het
Pcsk5	T	A	19: 17,632,182 (GRCm39)	Y328F	probably damaging	Het
Plxnb1	T	C	9: 108,942,769 (GRCm39)	L1810P	probably benign	Het
Polr2h	T	A	16: 20,537,649 (GRCm39)	V50E	probably damaging	Het
Ppm1g	T	C	5: 31,364,895 (GRCm39)		probably benign	Het
Ptpru	T	A	4: 131,525,259 (GRCm39)	R741S	probably benign	Het
Pyroxd2	T	C	19: 42,735,986 (GRCm39)	E64G	probably damaging	Het
Rad54b	T	C	4: 11,609,471 (GRCm39)		probably null	Het
Rangap1	A	T	15: 81,594,703 (GRCm39)	D375E	probably benign	Het
Rhbdf1	G	A	11: 32,165,053 (GRCm39)	R107C	probably damaging	Het
Scaf11	T	C	15: 96,329,706 (GRCm39)	E140G	probably damaging	Het
Slitrk6	G	T	14: 110,987,530 (GRCm39)	H726N	probably benign	Het
Spry2	A	G	14: 106,130,524 (GRCm39)	C221R	probably damaging	Het
Stx2	C	T	5: 129,076,612 (GRCm39)	V24M	probably damaging	Het
Tent5b	T	C	4: 133,213,842 (GRCm39)	S238P	probably damaging	Het
Tll2	T	A	19: 41,116,902 (GRCm39)		probably null	Het
Ttyh3	C	A	5: 140,612,201 (GRCm39)		probably null	Het
Vmn2r116	T	C	17: 23,619,934 (GRCm39)	V556A	probably benign	Het
Xpo5	T	C	17: 46,533,576 (GRCm39)		probably benign	Het
Zc3h3	A	G	15: 75,709,328 (GRCm39)	S514P	probably benign	Het
Zfp277	A	C	12: 40,370,599 (GRCm39)		probably null	Het

Other mutations in Ifi207

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01776:Ifi207	APN	1	173,552,610 (GRCm39)	missense	probably damaging	1.00
IGL01864:Ifi207	APN	1	173,564,007 (GRCm39)	missense	possibly damaging	0.72
IGL02293:Ifi207	APN	1	173,551,314 (GRCm39)	missense	probably damaging	1.00
IGL02402:Ifi207	APN	1	173,555,159 (GRCm39)	missense	probably damaging	1.00
IGL03160:Ifi207	APN	1	173,562,670 (GRCm39)	splice site	probably benign
PIT4458001:Ifi207	UTSW	1	173,562,738 (GRCm39)	missense	unknown
R0043:Ifi207	UTSW	1	173,556,678 (GRCm39)	missense	possibly damaging	0.48
R0212:Ifi207	UTSW	1	173,563,964 (GRCm39)	missense	possibly damaging	0.85
R0395:Ifi207	UTSW	1	173,557,431 (GRCm39)	missense	possibly damaging	0.85
R0506:Ifi207	UTSW	1	173,563,878 (GRCm39)	missense	possibly damaging	0.52
R1302:Ifi207	UTSW	1	173,562,861 (GRCm39)	missense	possibly damaging	0.96
R1373:Ifi207	UTSW	1	173,557,913 (GRCm39)	missense	unknown
R1462:Ifi207	UTSW	1	173,552,513 (GRCm39)	missense	probably damaging	1.00
R1462:Ifi207	UTSW	1	173,552,513 (GRCm39)	missense	probably damaging	1.00
R1471:Ifi207	UTSW	1	173,557,629 (GRCm39)	missense	unknown
R1502:Ifi207	UTSW	1	173,556,872 (GRCm39)	missense	possibly damaging	0.56
R1533:Ifi207	UTSW	1	173,555,306 (GRCm39)	missense	probably benign	0.30
R1831:Ifi207	UTSW	1	173,559,992 (GRCm39)	missense	unknown
R1928:Ifi207	UTSW	1	173,557,211 (GRCm39)	missense	possibly damaging	0.68
R1982:Ifi207	UTSW	1	173,562,805 (GRCm39)	missense	probably benign	0.01
R2132:Ifi207	UTSW	1	173,557,337 (GRCm39)	missense	possibly damaging	0.84
R2248:Ifi207	UTSW	1	173,564,036 (GRCm39)	splice site	probably benign
R3703:Ifi207	UTSW	1	173,555,029 (GRCm39)	nonsense	probably null
R3741:Ifi207	UTSW	1	173,555,128 (GRCm39)	missense	probably damaging	1.00
R3846:Ifi207	UTSW	1	173,562,869 (GRCm39)	missense	probably benign	0.33
R4747:Ifi207	UTSW	1	173,556,633 (GRCm39)	missense	probably benign	0.00
R4772:Ifi207	UTSW	1	173,555,253 (GRCm39)	missense	probably damaging	1.00
R4776:Ifi207	UTSW	1	173,557,622 (GRCm39)	missense	unknown
R4855:Ifi207	UTSW	1	173,557,381 (GRCm39)	missense	probably damaging	0.96
R5170:Ifi207	UTSW	1	173,558,064 (GRCm39)	missense	unknown
R5244:Ifi207	UTSW	1	173,557,503 (GRCm39)	missense	probably benign	0.04
R5280:Ifi207	UTSW	1	173,557,870 (GRCm39)	missense	unknown
R5301:Ifi207	UTSW	1	173,556,977 (GRCm39)	missense	possibly damaging	0.83
R5334:Ifi207	UTSW	1	173,555,097 (GRCm39)	missense	probably benign	0.21
R5445:Ifi207	UTSW	1	173,555,363 (GRCm39)	missense	probably damaging	0.99
R5691:Ifi207	UTSW	1	173,559,992 (GRCm39)	missense	unknown
R5838:Ifi207	UTSW	1	173,559,953 (GRCm39)	missense	unknown
R6060:Ifi207	UTSW	1	173,558,093 (GRCm39)	missense	unknown
R6220:Ifi207	UTSW	1	173,557,112 (GRCm39)	missense	probably damaging	0.99
R6264:Ifi207	UTSW	1	173,555,111 (GRCm39)	missense	probably damaging	1.00
R6307:Ifi207	UTSW	1	173,552,619 (GRCm39)	missense	probably damaging	1.00
R6326:Ifi207	UTSW	1	173,557,532 (GRCm39)	missense	probably benign	0.01
R6394:Ifi207	UTSW	1	173,556,581 (GRCm39)	missense	probably benign	0.43
R6532:Ifi207	UTSW	1	173,557,211 (GRCm39)	missense	possibly damaging	0.68
R6660:Ifi207	UTSW	1	173,556,972 (GRCm39)	missense	probably benign	0.01
R6893:Ifi207	UTSW	1	173,555,208 (GRCm39)	missense	possibly damaging	0.95
R7190:Ifi207	UTSW	1	173,557,818 (GRCm39)	missense	unknown
R7192:Ifi207	UTSW	1	173,556,584 (GRCm39)	missense	not run
R7194:Ifi207	UTSW	1	173,557,490 (GRCm39)	missense	possibly damaging	0.84
R7327:Ifi207	UTSW	1	173,556,581 (GRCm39)	missense	probably benign	0.43
R7348:Ifi207	UTSW	1	173,556,762 (GRCm39)	small deletion	probably benign
R7404:Ifi207	UTSW	1	173,556,494 (GRCm39)	missense	possibly damaging	0.92
R7442:Ifi207	UTSW	1	173,554,997 (GRCm39)	missense	probably benign	0.03
R7784:Ifi207	UTSW	1	173,557,698 (GRCm39)	missense	unknown
R8041:Ifi207	UTSW	1	173,555,268 (GRCm39)	missense	possibly damaging	0.78
R8116:Ifi207	UTSW	1	173,557,746 (GRCm39)	missense	unknown
R8166:Ifi207	UTSW	1	173,557,504 (GRCm39)	missense	probably benign	0.10
R8166:Ifi207	UTSW	1	173,557,166 (GRCm39)	missense	possibly damaging	0.95
R8168:Ifi207	UTSW	1	173,557,504 (GRCm39)	missense	probably benign	0.10
R8383:Ifi207	UTSW	1	173,556,770 (GRCm39)	small deletion	probably benign
R8388:Ifi207	UTSW	1	173,557,016 (GRCm39)	frame shift	probably null
R8389:Ifi207	UTSW	1	173,557,016 (GRCm39)	frame shift	probably null
R8390:Ifi207	UTSW	1	173,557,016 (GRCm39)	frame shift	probably null
R8399:Ifi207	UTSW	1	173,557,844 (GRCm39)	missense	unknown
R8431:Ifi207	UTSW	1	173,558,070 (GRCm39)	missense	unknown
R8474:Ifi207	UTSW	1	173,556,605 (GRCm39)	missense	possibly damaging	0.63
R8505:Ifi207	UTSW	1	173,557,016 (GRCm39)	frame shift	probably null
R9009:Ifi207	UTSW	1	173,555,382 (GRCm39)	missense	probably damaging	0.97
R9061:Ifi207	UTSW	1	173,564,153 (GRCm39)	intron	probably benign
R9071:Ifi207	UTSW	1	173,557,764 (GRCm39)	missense	unknown
R9090:Ifi207	UTSW	1	173,556,762 (GRCm39)	small deletion	probably benign
R9323:Ifi207	UTSW	1	173,555,143 (GRCm39)	missense	probably damaging	1.00
R9407:Ifi207	UTSW	1	173,555,234 (GRCm39)	missense	probably damaging	1.00
R9493:Ifi207	UTSW	1	173,556,522 (GRCm39)	missense	probably benign	0.00
R9629:Ifi207	UTSW	1	173,556,561 (GRCm39)	small deletion	probably benign
RF009:Ifi207	UTSW	1	173,556,558 (GRCm39)	missense	probably benign	0.00
RF011:Ifi207	UTSW	1	173,556,687 (GRCm39)	missense	not run
RF032:Ifi207	UTSW	1	173,562,723 (GRCm39)	small deletion	probably benign
X0003:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0004:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0005:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0009:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0010:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0011:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0012:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0013:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0014:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0017:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0018:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0019:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0020:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0021:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0022:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0023:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0024:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0025:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0026:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0027:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0028:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0033:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0034:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0035:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0036:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0037:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0038:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0039:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0040:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0050:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0052:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0053:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0054:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0057:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0058:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0060:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0061:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0062:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0063:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0064:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0065:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0066:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
X0067:Ifi207	UTSW	1	173,556,548 (GRCm39)	missense	probably damaging	0.98
Z1177:Ifi207	UTSW	1	173,557,145 (GRCm39)	missense	probably damaging	1.00
Z1187:Ifi207	UTSW	1	173,558,093 (GRCm39)	missense	unknown
Z1192:Ifi207	UTSW	1	173,558,093 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTGGATTGTCCTTGCCAGGAAAAG -3'
(R):5'- CCCAAACAAGTGATGGTGCTGAAAG -3'

Sequencing Primer
(F):5'- CTATGGAAGGCAATGATTTCCTG -3'
(R):5'- TGGTGCTGAAAGTAACAGAACC -3'

Posted On

2013-10-16