Incidental Mutation 'R0843:Olfr1256'
ID77242
Institutional Source Beutler Lab
Gene Symbol Olfr1256
Ensembl Gene ENSMUSG00000075073
Gene Nameolfactory receptor 1256
SynonymsGA_x6K02T2Q125-51276848-51275928, MOR231-1
MMRRC Submission 039022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0843 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89825311-89841555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89835616 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 110 (V110I)
Ref Sequence ENSEMBL: ENSMUSP00000149123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099763] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000215613]
Predicted Effect probably benign
Transcript: ENSMUST00000099763
AA Change: V110I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097351
Gene: ENSMUSG00000075073
AA Change: V110I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 5.3e-28 PFAM
Pfam:7tm_4 137 278 7.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111520
AA Change: V110I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073
AA Change: V110I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213833
AA Change: V110I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215613
AA Change: V110I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0998 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,071 R228G probably benign Het
Arrdc3 T C 13: 80,890,803 probably benign Het
Cacna1d T C 14: 30,124,871 Y526C probably damaging Het
Cenpn T C 8: 116,933,306 V125A probably benign Het
Cyfip1 A T 7: 55,922,820 H963L probably benign Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
Dnmt3a T C 12: 3,872,886 probably benign Het
Dync1h1 C T 12: 110,665,213 T4448M possibly damaging Het
Efr3a T A 15: 65,837,423 probably benign Het
Fam46b T C 4: 133,486,531 S238P probably damaging Het
Fgf11 T G 11: 69,798,776 probably benign Het
Gabrr1 T A 4: 33,161,717 I347N possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hspa1b T A 17: 34,957,548 N487I possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Iqgap3 A G 3: 88,108,431 D40G possibly damaging Het
Iyd T C 10: 3,545,663 V107A possibly damaging Het
Kctd3 A T 1: 188,996,973 L129* probably null Het
Myo7b A G 18: 31,974,084 F1286S possibly damaging Het
Olfr591 T A 7: 103,173,119 T173S possibly damaging Het
Olfr893 T A 9: 38,209,283 F77I possibly damaging Het
Pcsk5 T A 19: 17,654,818 Y328F probably damaging Het
Plxnb1 T C 9: 109,113,701 L1810P probably benign Het
Polr2h T A 16: 20,718,899 V50E probably damaging Het
Ppm1g T C 5: 31,207,551 probably benign Het
Ptpru T A 4: 131,797,948 R741S probably benign Het
Pyroxd2 T C 19: 42,747,547 E64G probably damaging Het
Rad54b T C 4: 11,609,471 probably null Het
Rangap1 A T 15: 81,710,502 D375E probably benign Het
Rhbdf1 G A 11: 32,215,053 R107C probably damaging Het
Scaf11 T C 15: 96,431,825 E140G probably damaging Het
Slitrk6 G T 14: 110,750,098 H726N probably benign Het
Spry2 A G 14: 105,893,090 C221R probably damaging Het
Stx2 C T 5: 128,999,548 V24M probably damaging Het
Tll2 T A 19: 41,128,463 probably null Het
Ttyh3 C A 5: 140,626,446 probably null Het
Vmn2r116 T C 17: 23,400,960 V556A probably benign Het
Xpo5 T C 17: 46,222,650 probably benign Het
Zc3h3 A G 15: 75,837,479 S514P probably benign Het
Zfp277 A C 12: 40,320,600 probably null Het
Other mutations in Olfr1256
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Olfr1256 APN 2 89835458 nonsense probably null
IGL01082:Olfr1256 APN 2 89844063 unclassified probably benign
IGL01613:Olfr1256 APN 2 89835808 missense probably damaging 0.98
IGL01969:Olfr1256 APN 2 89835720 missense probably benign 0.01
IGL02625:Olfr1256 APN 2 89835396 missense probably damaging 1.00
R1270:Olfr1256 UTSW 2 89835322 missense possibly damaging 0.90
R1521:Olfr1256 UTSW 2 89835172 nonsense probably null
R2219:Olfr1256 UTSW 2 89835425 missense probably damaging 1.00
R2881:Olfr1256 UTSW 2 89844984 splice site probably null
R3121:Olfr1256 UTSW 2 89835514 missense probably benign
R3609:Olfr1256 UTSW 2 89835076 missense probably damaging 0.99
R4984:Olfr1256 UTSW 2 89835813 missense probably damaging 1.00
R5153:Olfr1256 UTSW 2 89835234 missense possibly damaging 0.77
R5640:Olfr1256 UTSW 2 89835938 missense probably benign 0.08
R7198:Olfr1256 UTSW 2 89835732 missense probably damaging 1.00
R7862:Olfr1256 UTSW 2 89835124 missense probably benign 0.16
R8100:Olfr1256 UTSW 2 89835685 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCATCACTAAGAGGCCAATGAC -3'
(R):5'- CCAAAGGTGCAGAAAGGACTTTTCG -3'

Sequencing Primer
(F):5'- TTCAGTAAGGGGTACATGTCACAC -3'
(R):5'- TGTAACTACCAGTAACAGCCTG -3'
Posted On2013-10-16