Incidental Mutation 'R0843:Fam46b'
ID77247
Institutional Source Beutler Lab
Gene Symbol Fam46b
Ensembl Gene ENSMUSG00000046694
Gene Namefamily with sequence similarity 46, member B
Synonyms
MMRRC Submission 039022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R0843 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133480132-133487938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133486531 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 238 (S238P)
Ref Sequence ENSEMBL: ENSMUSP00000056015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051676] [ENSMUST00000125541]
Predicted Effect probably damaging
Transcript: ENSMUST00000051676
AA Change: S238P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056015
Gene: ENSMUSG00000046694
AA Change: S238P

DomainStartEndE-ValueType
low complexity region 15 44 N/A INTRINSIC
DUF1693 52 372 2.52e-218 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123169
Predicted Effect probably benign
Transcript: ENSMUST00000125541
SMART Domains Protein: ENSMUSP00000129613
Gene: ENSMUSG00000056596

DomainStartEndE-ValueType
low complexity region 20 54 N/A INTRINSIC
low complexity region 72 124 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
low complexity region 164 189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132840
Meta Mutation Damage Score 0.3103 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,071 R228G probably benign Het
Arrdc3 T C 13: 80,890,803 probably benign Het
Cacna1d T C 14: 30,124,871 Y526C probably damaging Het
Cenpn T C 8: 116,933,306 V125A probably benign Het
Cyfip1 A T 7: 55,922,820 H963L probably benign Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
Dnmt3a T C 12: 3,872,886 probably benign Het
Dync1h1 C T 12: 110,665,213 T4448M possibly damaging Het
Efr3a T A 15: 65,837,423 probably benign Het
Fgf11 T G 11: 69,798,776 probably benign Het
Gabrr1 T A 4: 33,161,717 I347N possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hspa1b T A 17: 34,957,548 N487I possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Iqgap3 A G 3: 88,108,431 D40G possibly damaging Het
Iyd T C 10: 3,545,663 V107A possibly damaging Het
Kctd3 A T 1: 188,996,973 L129* probably null Het
Myo7b A G 18: 31,974,084 F1286S possibly damaging Het
Olfr1256 C T 2: 89,835,616 V110I probably benign Het
Olfr591 T A 7: 103,173,119 T173S possibly damaging Het
Olfr893 T A 9: 38,209,283 F77I possibly damaging Het
Pcsk5 T A 19: 17,654,818 Y328F probably damaging Het
Plxnb1 T C 9: 109,113,701 L1810P probably benign Het
Polr2h T A 16: 20,718,899 V50E probably damaging Het
Ppm1g T C 5: 31,207,551 probably benign Het
Ptpru T A 4: 131,797,948 R741S probably benign Het
Pyroxd2 T C 19: 42,747,547 E64G probably damaging Het
Rad54b T C 4: 11,609,471 probably null Het
Rangap1 A T 15: 81,710,502 D375E probably benign Het
Rhbdf1 G A 11: 32,215,053 R107C probably damaging Het
Scaf11 T C 15: 96,431,825 E140G probably damaging Het
Slitrk6 G T 14: 110,750,098 H726N probably benign Het
Spry2 A G 14: 105,893,090 C221R probably damaging Het
Stx2 C T 5: 128,999,548 V24M probably damaging Het
Tll2 T A 19: 41,128,463 probably null Het
Ttyh3 C A 5: 140,626,446 probably null Het
Vmn2r116 T C 17: 23,400,960 V556A probably benign Het
Xpo5 T C 17: 46,222,650 probably benign Het
Zc3h3 A G 15: 75,837,479 S514P probably benign Het
Zfp277 A C 12: 40,320,600 probably null Het
Other mutations in Fam46b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Fam46b APN 4 133486522 unclassified probably null
IGL01871:Fam46b APN 4 133486309 missense possibly damaging 0.89
IGL02218:Fam46b APN 4 133486151 missense probably damaging 1.00
IGL02222:Fam46b APN 4 133486553 missense probably damaging 0.99
R0345:Fam46b UTSW 4 133486211 missense probably benign 0.01
R0515:Fam46b UTSW 4 133486139 missense possibly damaging 0.92
R1240:Fam46b UTSW 4 133486504 missense probably benign 0.01
R2042:Fam46b UTSW 4 133486613 missense possibly damaging 0.82
R4328:Fam46b UTSW 4 133486603 nonsense probably null
R4811:Fam46b UTSW 4 133486370 missense probably benign 0.01
R4868:Fam46b UTSW 4 133486082 critical splice acceptor site probably null
R5056:Fam46b UTSW 4 133480438 missense possibly damaging 0.91
R6360:Fam46b UTSW 4 133486756 missense probably damaging 0.99
R6454:Fam46b UTSW 4 133480409 missense probably damaging 1.00
R7017:Fam46b UTSW 4 133486234 missense possibly damaging 0.95
R7186:Fam46b UTSW 4 133486207 missense probably damaging 1.00
R7315:Fam46b UTSW 4 133487084 missense probably damaging 1.00
Z1176:Fam46b UTSW 4 133486682 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATCTCTCTGTCCAACAAGAGCG -3'
(R):5'- GCAGTGTCACAAGGCAAGCATACC -3'

Sequencing Primer
(F):5'- TCTGTCCAACAAGAGCGGTAAG -3'
(R):5'- CGGGAACACATGTATCGCTG -3'
Posted On2013-10-16