Incidental Mutation 'R0843:Olfr591'
ID77252
Institutional Source Beutler Lab
Gene Symbol Olfr591
Ensembl Gene ENSMUSG00000057461
Gene Nameolfactory receptor 591
SynonymsMOR24-1P, GA_x6K02T2PBJ9-5889409-5888465
MMRRC Submission 039022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0843 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103167074-103178340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103173119 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 173 (T173S)
Ref Sequence ENSEMBL: ENSMUSP00000150894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074272] [ENSMUST00000216581]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074272
AA Change: T173S

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073884
Gene: ENSMUSG00000057461
AA Change: T173S

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 9.4e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 255 7.1e-8 PFAM
Pfam:7tm_1 43 294 6.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216581
AA Change: T173S

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218115
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,071 R228G probably benign Het
Arrdc3 T C 13: 80,890,803 probably benign Het
Cacna1d T C 14: 30,124,871 Y526C probably damaging Het
Cenpn T C 8: 116,933,306 V125A probably benign Het
Cyfip1 A T 7: 55,922,820 H963L probably benign Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
Dnmt3a T C 12: 3,872,886 probably benign Het
Dync1h1 C T 12: 110,665,213 T4448M possibly damaging Het
Efr3a T A 15: 65,837,423 probably benign Het
Fam46b T C 4: 133,486,531 S238P probably damaging Het
Fgf11 T G 11: 69,798,776 probably benign Het
Gabrr1 T A 4: 33,161,717 I347N possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hspa1b T A 17: 34,957,548 N487I possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Iqgap3 A G 3: 88,108,431 D40G possibly damaging Het
Iyd T C 10: 3,545,663 V107A possibly damaging Het
Kctd3 A T 1: 188,996,973 L129* probably null Het
Myo7b A G 18: 31,974,084 F1286S possibly damaging Het
Olfr1256 C T 2: 89,835,616 V110I probably benign Het
Olfr893 T A 9: 38,209,283 F77I possibly damaging Het
Pcsk5 T A 19: 17,654,818 Y328F probably damaging Het
Plxnb1 T C 9: 109,113,701 L1810P probably benign Het
Polr2h T A 16: 20,718,899 V50E probably damaging Het
Ppm1g T C 5: 31,207,551 probably benign Het
Ptpru T A 4: 131,797,948 R741S probably benign Het
Pyroxd2 T C 19: 42,747,547 E64G probably damaging Het
Rad54b T C 4: 11,609,471 probably null Het
Rangap1 A T 15: 81,710,502 D375E probably benign Het
Rhbdf1 G A 11: 32,215,053 R107C probably damaging Het
Scaf11 T C 15: 96,431,825 E140G probably damaging Het
Slitrk6 G T 14: 110,750,098 H726N probably benign Het
Spry2 A G 14: 105,893,090 C221R probably damaging Het
Stx2 C T 5: 128,999,548 V24M probably damaging Het
Tll2 T A 19: 41,128,463 probably null Het
Ttyh3 C A 5: 140,626,446 probably null Het
Vmn2r116 T C 17: 23,400,960 V556A probably benign Het
Xpo5 T C 17: 46,222,650 probably benign Het
Zc3h3 A G 15: 75,837,479 S514P probably benign Het
Zfp277 A C 12: 40,320,600 probably null Het
Other mutations in Olfr591
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Olfr591 APN 7 103173451 missense probably damaging 1.00
IGL03307:Olfr591 APN 7 103173416 missense probably benign 0.00
G1Funyon:Olfr591 UTSW 7 103173073 missense probably damaging 0.99
R0082:Olfr591 UTSW 7 103173202 missense probably benign 0.05
R0389:Olfr591 UTSW 7 103173283 missense possibly damaging 0.48
R1378:Olfr591 UTSW 7 103173268 missense probably damaging 1.00
R1386:Olfr591 UTSW 7 103173367 missense probably benign 0.11
R1521:Olfr591 UTSW 7 103173451 missense probably benign 0.39
R1538:Olfr591 UTSW 7 103172986 missense probably damaging 0.97
R3108:Olfr591 UTSW 7 103173086 missense probably damaging 0.98
R3109:Olfr591 UTSW 7 103173086 missense probably damaging 0.98
R5350:Olfr591 UTSW 7 103173559 missense probably damaging 0.99
R5488:Olfr591 UTSW 7 103173451 missense probably damaging 1.00
R5489:Olfr591 UTSW 7 103173451 missense probably damaging 1.00
R5598:Olfr591 UTSW 7 103173634 start codon destroyed probably null 1.00
R5607:Olfr591 UTSW 7 103172849 missense probably damaging 0.96
R5608:Olfr591 UTSW 7 103172849 missense probably damaging 0.96
R6974:Olfr591 UTSW 7 103173235 missense probably damaging 0.99
R6994:Olfr591 UTSW 7 103172912 missense probably damaging 1.00
R7095:Olfr591 UTSW 7 103173046 missense probably benign 0.00
R7966:Olfr591 UTSW 7 103172855 missense probably damaging 0.99
R7980:Olfr591 UTSW 7 103173035 missense probably damaging 1.00
R8301:Olfr591 UTSW 7 103173073 missense probably damaging 0.99
R8831:Olfr591 UTSW 7 103172996 missense probably benign 0.01
Z1088:Olfr591 UTSW 7 103172806 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGAGCCACTTTGTGCCCAAAC -3'
(R):5'- CCTTGTAGGAATGGCCTTTGACCG -3'

Sequencing Primer
(F):5'- CCAGAGTCTTGAGTCTGGCATC -3'
(R):5'- GAATGGCCTTTGACCGTTATG -3'
Posted On2013-10-16