Incidental Mutation 'R0843:Spry2'
ID77265
Institutional Source Beutler Lab
Gene Symbol Spry2
Ensembl Gene ENSMUSG00000022114
Gene Namesprouty RTK signaling antagonist 2
Synonymssprouty2
MMRRC Submission 039022-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R0843 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location105891947-105896819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105893090 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 221 (C221R)
Ref Sequence ENSEMBL: ENSMUSP00000022709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022709]
Predicted Effect probably damaging
Transcript: ENSMUST00000022709
AA Change: C221R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022709
Gene: ENSMUSG00000022114
AA Change: C221R

DomainStartEndE-ValueType
low complexity region 107 130 N/A INTRINSIC
Pfam:Sprouty 183 301 2.8e-38 PFAM
Meta Mutation Damage Score 0.8977 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the sprouty family. The encoded protein contains a carboxyl-terminal cysteine-rich domain essential for the inhibitory activity on receptor tyrosine kinase signaling proteins and is required for growth factor stimulated translocation of the protein to membrane ruffles. In primary dermal endothelial cells this gene is transiently upregulated in response to fibroblast growth factor two. This protein is indirectly involved in the non-cell autonomous inhibitory effect on fibroblast growth factor two signaling. The protein interacts with Cas-Br-M (murine) ectropic retroviral transforming sequence, and can function as a bimodal regulator of epidermal growth factor receptor/mitogen-activated protein kinase signaling. This protein may play a role in alveoli branching during lung development as shown by a similar mouse protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit enteric nerve hyperplasia which led to esophangeal achalasia and intestinal pseudo-obstruction. Mice also have intermediate to severe hearing loss with abnormalities in the organ of Corti and about half die prematurely. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,071 R228G probably benign Het
Arrdc3 T C 13: 80,890,803 probably benign Het
Cacna1d T C 14: 30,124,871 Y526C probably damaging Het
Cenpn T C 8: 116,933,306 V125A probably benign Het
Cyfip1 A T 7: 55,922,820 H963L probably benign Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
Dnmt3a T C 12: 3,872,886 probably benign Het
Dync1h1 C T 12: 110,665,213 T4448M possibly damaging Het
Efr3a T A 15: 65,837,423 probably benign Het
Fam46b T C 4: 133,486,531 S238P probably damaging Het
Fgf11 T G 11: 69,798,776 probably benign Het
Gabrr1 T A 4: 33,161,717 I347N possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hspa1b T A 17: 34,957,548 N487I possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Iqgap3 A G 3: 88,108,431 D40G possibly damaging Het
Iyd T C 10: 3,545,663 V107A possibly damaging Het
Kctd3 A T 1: 188,996,973 L129* probably null Het
Myo7b A G 18: 31,974,084 F1286S possibly damaging Het
Olfr1256 C T 2: 89,835,616 V110I probably benign Het
Olfr591 T A 7: 103,173,119 T173S possibly damaging Het
Olfr893 T A 9: 38,209,283 F77I possibly damaging Het
Pcsk5 T A 19: 17,654,818 Y328F probably damaging Het
Plxnb1 T C 9: 109,113,701 L1810P probably benign Het
Polr2h T A 16: 20,718,899 V50E probably damaging Het
Ppm1g T C 5: 31,207,551 probably benign Het
Ptpru T A 4: 131,797,948 R741S probably benign Het
Pyroxd2 T C 19: 42,747,547 E64G probably damaging Het
Rad54b T C 4: 11,609,471 probably null Het
Rangap1 A T 15: 81,710,502 D375E probably benign Het
Rhbdf1 G A 11: 32,215,053 R107C probably damaging Het
Scaf11 T C 15: 96,431,825 E140G probably damaging Het
Slitrk6 G T 14: 110,750,098 H726N probably benign Het
Stx2 C T 5: 128,999,548 V24M probably damaging Het
Tll2 T A 19: 41,128,463 probably null Het
Ttyh3 C A 5: 140,626,446 probably null Het
Vmn2r116 T C 17: 23,400,960 V556A probably benign Het
Xpo5 T C 17: 46,222,650 probably benign Het
Zc3h3 A G 15: 75,837,479 S514P probably benign Het
Zfp277 A C 12: 40,320,600 probably null Het
Other mutations in Spry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Spry2 APN 14 105893054 missense probably damaging 1.00
eagle UTSW 14 105893357 nonsense probably null
Osprey UTSW 14 105892984 missense possibly damaging 0.92
R0016:Spry2 UTSW 14 105893297 missense probably benign 0.08
R0594:Spry2 UTSW 14 105893310 missense possibly damaging 0.50
R0943:Spry2 UTSW 14 105893587 missense probably damaging 1.00
R1186:Spry2 UTSW 14 105892907 missense probably damaging 1.00
R4052:Spry2 UTSW 14 105893201 missense probably damaging 1.00
R5355:Spry2 UTSW 14 105893278 missense probably damaging 0.97
R6306:Spry2 UTSW 14 105892984 missense possibly damaging 0.92
R6822:Spry2 UTSW 14 105893357 nonsense probably null
R7347:Spry2 UTSW 14 105893512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCGGAGCAACAATCCCTATTAC -3'
(R):5'- AGCCACTGAGCAAGGATGATTTGG -3'

Sequencing Primer
(F):5'- CAGTGGGAACTTTGCAGC -3'
(R):5'- CTGGATCTGTGACAAGCAGT -3'
Posted On2013-10-16