Mutagenetix > Incidental Mutation

Incidental Mutation 'R0843:Vmn2r116'

77272

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r116

Ensembl Gene

ENSMUSG00000090966

Gene Name

vomeronasal 2, receptor 116

Synonyms

V2Rp5, EG619697

MMRRC Submission

039022-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R0843 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23384803-23401864 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23400960 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 556 (V556A)

Ref Sequence

ENSEMBL: ENSMUSP00000128106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164856]

AlphaFold

E9Q6I0

Predicted Effect

probably benign
Transcript: ENSMUST00000164856
AA Change: V556A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: V556A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	4.4e-30	PFAM
Pfam:NCD3G	511	564	1.2e-22	PFAM
low complexity region	589	594	N/A	INTRINSIC
Pfam:7tm_3	595	832	8.7e-57	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.5%
20x: 92.6%

Validation Efficiency

98% (40/41)

MGI Phenotype

PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adrb2	T	C	18: 62,179,071	R228G	probably benign	Het
Arrdc3	T	C	13: 80,890,803		probably benign	Het
Cacna1d	T	C	14: 30,124,871	Y526C	probably damaging	Het
Cenpn	T	C	8: 116,933,306	V125A	probably benign	Het
Cyfip1	A	T	7: 55,922,820	H963L	probably benign	Het
Dnah8	T	C	17: 30,813,095	Y4130H	probably damaging	Het
Dnmt3a	T	C	12: 3,872,886		probably benign	Het
Dync1h1	C	T	12: 110,665,213	T4448M	possibly damaging	Het
Efr3a	T	A	15: 65,837,423		probably benign	Het
Fam46b	T	C	4: 133,486,531	S238P	probably damaging	Het
Fgf11	T	G	11: 69,798,776		probably benign	Het
Gabrr1	T	A	4: 33,161,717	I347N	possibly damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Hspa1b	T	A	17: 34,957,548	N487I	possibly damaging	Het
Ifi207	A	T	1: 173,727,577	N853K	probably damaging	Het
Iqgap3	A	G	3: 88,108,431	D40G	possibly damaging	Het
Iyd	T	C	10: 3,545,663	V107A	possibly damaging	Het
Kctd3	A	T	1: 188,996,973	L129*	probably null	Het
Myo7b	A	G	18: 31,974,084	F1286S	possibly damaging	Het
Olfr1256	C	T	2: 89,835,616	V110I	probably benign	Het
Olfr591	T	A	7: 103,173,119	T173S	possibly damaging	Het
Olfr893	T	A	9: 38,209,283	F77I	possibly damaging	Het
Pcsk5	T	A	19: 17,654,818	Y328F	probably damaging	Het
Plxnb1	T	C	9: 109,113,701	L1810P	probably benign	Het
Polr2h	T	A	16: 20,718,899	V50E	probably damaging	Het
Ppm1g	T	C	5: 31,207,551		probably benign	Het
Ptpru	T	A	4: 131,797,948	R741S	probably benign	Het
Pyroxd2	T	C	19: 42,747,547	E64G	probably damaging	Het
Rad54b	T	C	4: 11,609,471		probably null	Het
Rangap1	A	T	15: 81,710,502	D375E	probably benign	Het
Rhbdf1	G	A	11: 32,215,053	R107C	probably damaging	Het
Scaf11	T	C	15: 96,431,825	E140G	probably damaging	Het
Slitrk6	G	T	14: 110,750,098	H726N	probably benign	Het
Spry2	A	G	14: 105,893,090	C221R	probably damaging	Het
Stx2	C	T	5: 128,999,548	V24M	probably damaging	Het
Tll2	T	A	19: 41,128,463		probably null	Het
Ttyh3	C	A	5: 140,626,446		probably null	Het
Xpo5	T	C	17: 46,222,650		probably benign	Het
Zc3h3	A	G	15: 75,837,479	S514P	probably benign	Het
Zfp277	A	C	12: 40,320,600		probably null	Het

Other mutations in Vmn2r116

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Vmn2r116	APN	17	23385995	missense	possibly damaging	0.94
IGL00985:Vmn2r116	APN	17	23401515	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23397727	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23387236	missense	probably benign	0.12
IGL01383:Vmn2r116	APN	17	23401601	missense	probably damaging	1.00
IGL01459:Vmn2r116	APN	17	23384929	missense	probably damaging	1.00
IGL01725:Vmn2r116	APN	17	23386645	missense	probably damaging	1.00
IGL02125:Vmn2r116	APN	17	23397627	splice site	probably benign
IGL02170:Vmn2r116	APN	17	23384933	missense	probably benign
IGL02209:Vmn2r116	APN	17	23388787	missense	probably damaging	1.00
IGL02226:Vmn2r116	APN	17	23384834	missense	probably null
IGL02272:Vmn2r116	APN	17	23385999	missense	probably benign	0.06
IGL02272:Vmn2r116	APN	17	23386004	missense	probably damaging	1.00
IGL02403:Vmn2r116	APN	17	23387364	missense	probably damaging	1.00
IGL02686:Vmn2r116	APN	17	23388793	missense	probably damaging	0.99
IGL02750:Vmn2r116	APN	17	23397634	splice site	probably benign
IGL02977:Vmn2r116	APN	17	23388774	missense	possibly damaging	0.90
PIT4449001:Vmn2r116	UTSW	17	23388947	missense	probably benign	0.41
R0015:Vmn2r116	UTSW	17	23401849	missense	probably benign	0.03
R0219:Vmn2r116	UTSW	17	23386098	nonsense	probably null
R0281:Vmn2r116	UTSW	17	23401413	missense	possibly damaging	0.90
R0415:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
R0592:Vmn2r116	UTSW	17	23386915	missense	probably damaging	0.99
R0610:Vmn2r116	UTSW	17	23387312	missense	probably damaging	1.00
R0635:Vmn2r116	UTSW	17	23386887	missense	possibly damaging	0.95
R1329:Vmn2r116	UTSW	17	23387188	missense	possibly damaging	0.89
R1396:Vmn2r116	UTSW	17	23386141	missense	probably benign
R1401:Vmn2r116	UTSW	17	23386596	splice site	probably benign
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1766:Vmn2r116	UTSW	17	23401766	missense	probably damaging	0.98
R2157:Vmn2r116	UTSW	17	23401469	missense	probably damaging	1.00
R3622:Vmn2r116	UTSW	17	23386051	missense	probably benign	0.11
R3690:Vmn2r116	UTSW	17	23384824	missense	unknown
R4298:Vmn2r116	UTSW	17	23401827	missense	possibly damaging	0.69
R4373:Vmn2r116	UTSW	17	23401421	missense	probably benign	0.01
R4860:Vmn2r116	UTSW	17	23401803	missense	probably benign
R4941:Vmn2r116	UTSW	17	23401142	missense	probably damaging	1.00
R5119:Vmn2r116	UTSW	17	23387164	missense	probably benign	0.01
R5503:Vmn2r116	UTSW	17	23386804	missense	probably benign	0.07
R5510:Vmn2r116	UTSW	17	23386121	missense	probably damaging	1.00
R5538:Vmn2r116	UTSW	17	23401067	missense	probably benign	0.00
R5689:Vmn2r116	UTSW	17	23397719	missense	probably benign	0.30
R5765:Vmn2r116	UTSW	17	23401404	missense	probably damaging	0.99
R5794:Vmn2r116	UTSW	17	23385968	missense	probably damaging	0.99
R5807:Vmn2r116	UTSW	17	23387307	missense	probably damaging	1.00
R5837:Vmn2r116	UTSW	17	23387080	missense	probably damaging	1.00
R6262:Vmn2r116	UTSW	17	23387377	missense	probably benign	0.03
R6298:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R6651:Vmn2r116	UTSW	17	23388831	nonsense	probably null
R6667:Vmn2r116	UTSW	17	23401092	missense	probably damaging	1.00
R7393:Vmn2r116	UTSW	17	23386125	missense	probably benign	0.14
R7571:Vmn2r116	UTSW	17	23384856	splice site	probably null
R7940:Vmn2r116	UTSW	17	23386972	missense	probably damaging	0.99
R8510:Vmn2r116	UTSW	17	23385931	nonsense	probably null
R8950:Vmn2r116	UTSW	17	23401493	missense	probably damaging	1.00
R8956:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R8977:Vmn2r116	UTSW	17	23386942	missense	possibly damaging	0.56
R9030:Vmn2r116	UTSW	17	23384890	missense	possibly damaging	0.82
R9077:Vmn2r116	UTSW	17	23385982	missense	probably benign	0.14
R9223:Vmn2r116	UTSW	17	23401167	missense	probably damaging	1.00
R9401:Vmn2r116	UTSW	17	23401592	missense	probably damaging	1.00
R9449:Vmn2r116	UTSW	17	23386945	missense	probably benign	0.01
R9746:Vmn2r116	UTSW	17	23401823	missense	probably benign	0.08
R9755:Vmn2r116	UTSW	17	23401091	missense	probably damaging	1.00
R9759:Vmn2r116	UTSW	17	23401386	missense	possibly damaging	0.90
R9800:Vmn2r116	UTSW	17	23401425	missense	probably damaging	0.97
S24628:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
Z1176:Vmn2r116	UTSW	17	23401428	missense	probably damaging	1.00
Z1177:Vmn2r116	UTSW	17	23388892	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTTGCTTTCATTTCCCTAATAATCATCACCA -3'
(R):5'- GCTCTCAGCCAGACTGCACATACAATAA -3'

Sequencing Primer
(F):5'- caccacctcagtctccattc -3'
(R):5'- GGCTATGATTTTGAATGCCAGAAC -3'

Posted On

2013-10-16