Incidental Mutation 'R0844:Itga10'
ID77283
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
MMRRC Submission 039023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0844 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 96651738 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]
Predicted Effect probably benign
Transcript: ENSMUST00000029744
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119365
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 100% (27/27)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T C 12: 55,080,073 D2G possibly damaging Het
5330417C22Rik T C 3: 108,480,963 probably benign Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Asb2 T C 12: 103,325,546 H374R probably damaging Het
Clca4b A G 3: 144,916,771 I511T probably damaging Het
Cnmd G A 14: 79,641,951 T249I probably benign Het
Cyp4a12b T G 4: 115,432,524 M196R possibly damaging Het
Ddx60 T C 8: 61,987,361 Y1016H probably benign Het
Ero1l A G 14: 45,293,000 L325P probably damaging Het
Etv1 T C 12: 38,861,354 L393P probably damaging Het
Fdx1 G T 9: 51,948,609 D33E probably damaging Het
Gm156 C G 6: 129,775,793 K16N possibly damaging Het
Gpr180 T C 14: 118,157,947 C264R probably damaging Het
Grik2 A T 10: 49,101,115 M907K possibly damaging Het
Mpdz A G 4: 81,421,194 probably benign Het
Myo9b C T 8: 71,290,475 S60L probably benign Het
Naxe A T 3: 88,058,408 V28E probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Otog T C 7: 46,287,828 S1654P possibly damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Spag17 A G 3: 100,004,785 T324A probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tbc1d12 G T 19: 38,837,071 R122L probably benign Het
Tmx4 A G 2: 134,600,008 probably null Het
Trnt1 A G 6: 106,774,503 D147G probably damaging Het
Trpm7 A T 2: 126,835,508 V463E probably damaging Het
Wdr82 G A 9: 106,188,581 probably benign Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7638:Itga10 UTSW 3 96657391 splice site probably null
R7639:Itga10 UTSW 3 96649582 missense probably benign 0.36
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R8297:Itga10 UTSW 3 96654800 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGGATAGACCCTGACCCTCTCAAC -3'
(R):5'- GGTTTCCTGAAGGCATAAGGCGAG -3'

Sequencing Primer
(F):5'- ATAAGCCCCCTACTTCTAATTCAG -3'
(R):5'- CTAAGGGGGAGTGCCTCATAC -3'
Posted On2013-10-16