Incidental Mutation 'R0844:Otog'
ID 77291
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Name otogelin
Synonyms Otgn
MMRRC Submission 039023-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.770) question?
Stock # R0844 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45890411-45960858 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45937252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1654 (S1654P)
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000164538
AA Change: S1654P

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: S1654P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Meta Mutation Damage Score 0.1121 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 100% (27/27)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T C 12: 55,126,858 (GRCm39) D2G possibly damaging Het
Abca5 T C 11: 110,210,658 (GRCm39) T174A probably benign Het
Asb2 T C 12: 103,291,805 (GRCm39) H374R probably damaging Het
Clca4b A G 3: 144,622,532 (GRCm39) I511T probably damaging Het
Cnmd G A 14: 79,879,391 (GRCm39) T249I probably benign Het
Cyp4a12b T G 4: 115,289,721 (GRCm39) M196R possibly damaging Het
Ddx60 T C 8: 62,440,395 (GRCm39) Y1016H probably benign Het
Elapor1 T C 3: 108,388,279 (GRCm39) probably benign Het
Ero1a A G 14: 45,530,457 (GRCm39) L325P probably damaging Het
Etv1 T C 12: 38,911,353 (GRCm39) L393P probably damaging Het
Fdx1 G T 9: 51,859,909 (GRCm39) D33E probably damaging Het
Gpr180 T C 14: 118,395,359 (GRCm39) C264R probably damaging Het
Grik2 A T 10: 48,977,211 (GRCm39) M907K possibly damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Klrh1 C G 6: 129,752,756 (GRCm39) K16N possibly damaging Het
Mpdz A G 4: 81,339,431 (GRCm39) probably benign Het
Myo9b C T 8: 71,743,119 (GRCm39) S60L probably benign Het
Naxe A T 3: 87,965,715 (GRCm39) V28E probably benign Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Setd1b C T 5: 123,298,748 (GRCm39) probably benign Het
Spag17 A G 3: 99,912,101 (GRCm39) T324A probably benign Het
Sucla2 C T 14: 73,798,074 (GRCm39) probably benign Het
Tbc1d12 G T 19: 38,825,515 (GRCm39) R122L probably benign Het
Tmx4 A G 2: 134,441,928 (GRCm39) probably null Het
Trnt1 A G 6: 106,751,464 (GRCm39) D147G probably damaging Het
Trpm7 A T 2: 126,677,428 (GRCm39) V463E probably damaging Het
Wdr82 G A 9: 106,065,780 (GRCm39) probably benign Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 45,900,706 (GRCm39) missense probably damaging 1.00
IGL00725:Otog APN 7 45,923,516 (GRCm39) missense probably damaging 1.00
IGL00757:Otog APN 7 45,939,552 (GRCm39) missense probably damaging 1.00
IGL00822:Otog APN 7 45,945,304 (GRCm39) missense probably benign 0.24
IGL01354:Otog APN 7 45,939,150 (GRCm39) missense probably damaging 1.00
IGL01567:Otog APN 7 45,926,039 (GRCm39) splice site probably benign
IGL02034:Otog APN 7 45,945,417 (GRCm39) nonsense probably null
IGL02090:Otog APN 7 45,949,571 (GRCm39) missense probably damaging 1.00
IGL02132:Otog APN 7 45,954,903 (GRCm39) missense probably damaging 0.99
IGL02148:Otog APN 7 45,950,011 (GRCm39) missense probably damaging 1.00
IGL02173:Otog APN 7 45,926,165 (GRCm39) splice site probably benign
IGL02199:Otog APN 7 45,926,775 (GRCm39) missense possibly damaging 0.90
IGL02216:Otog APN 7 45,950,892 (GRCm39) missense probably damaging 1.00
IGL02322:Otog APN 7 45,950,881 (GRCm39) missense probably benign 0.01
IGL02330:Otog APN 7 45,937,493 (GRCm39) missense possibly damaging 0.84
IGL02529:Otog APN 7 45,909,381 (GRCm39) missense probably damaging 0.99
IGL02898:Otog APN 7 45,959,562 (GRCm39) missense probably damaging 1.00
IGL02970:Otog APN 7 45,945,291 (GRCm39) missense probably benign 0.11
IGL03085:Otog APN 7 45,955,346 (GRCm39) critical splice donor site probably null
IGL03108:Otog APN 7 45,900,762 (GRCm39) missense probably damaging 1.00
IGL03275:Otog APN 7 45,955,654 (GRCm39) missense probably damaging 1.00
R0282_Otog_616 UTSW 7 45,926,917 (GRCm39) missense possibly damaging 0.93
R0636_otog_678 UTSW 7 45,913,652 (GRCm39) critical splice donor site probably null
R1029_otog_141 UTSW 7 45,924,019 (GRCm39) missense probably damaging 1.00
BB010:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
BB020:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
I1329:Otog UTSW 7 45,895,927 (GRCm39) missense probably benign 0.02
IGL02984:Otog UTSW 7 45,954,932 (GRCm39) missense probably damaging 0.98
PIT4472001:Otog UTSW 7 45,945,273 (GRCm39) missense probably damaging 1.00
R0032:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0032:Otog UTSW 7 45,937,637 (GRCm39) nonsense probably null
R0105:Otog UTSW 7 45,937,790 (GRCm39) missense possibly damaging 0.79
R0164:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0164:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0165:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0166:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0167:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0240:Otog UTSW 7 45,913,456 (GRCm39) splice site probably null
R0240:Otog UTSW 7 45,913,456 (GRCm39) splice site probably null
R0242:Otog UTSW 7 45,916,805 (GRCm39) missense probably damaging 0.98
R0242:Otog UTSW 7 45,916,805 (GRCm39) missense probably damaging 0.98
R0282:Otog UTSW 7 45,926,917 (GRCm39) missense possibly damaging 0.93
R0392:Otog UTSW 7 45,899,499 (GRCm39) missense probably benign 0.00
R0436:Otog UTSW 7 45,915,360 (GRCm39) splice site probably benign
R0441:Otog UTSW 7 45,955,301 (GRCm39) missense probably damaging 1.00
R0499:Otog UTSW 7 45,923,256 (GRCm39) missense probably damaging 1.00
R0530:Otog UTSW 7 45,947,668 (GRCm39) missense probably damaging 0.98
R0541:Otog UTSW 7 45,918,673 (GRCm39) splice site probably benign
R0600:Otog UTSW 7 45,900,819 (GRCm39) splice site probably benign
R0626:Otog UTSW 7 45,920,797 (GRCm39) missense possibly damaging 0.95
R0636:Otog UTSW 7 45,913,652 (GRCm39) critical splice donor site probably null
R0764:Otog UTSW 7 45,949,918 (GRCm39) missense probably benign 0.00
R0833:Otog UTSW 7 45,918,786 (GRCm39) missense possibly damaging 0.94
R0836:Otog UTSW 7 45,918,786 (GRCm39) missense possibly damaging 0.94
R1029:Otog UTSW 7 45,924,019 (GRCm39) missense probably damaging 1.00
R1116:Otog UTSW 7 45,950,025 (GRCm39) splice site probably benign
R1134:Otog UTSW 7 45,947,938 (GRCm39) missense probably damaging 1.00
R1183:Otog UTSW 7 45,939,179 (GRCm39) missense probably benign 0.41
R1204:Otog UTSW 7 45,909,335 (GRCm39) missense probably benign 0.16
R1301:Otog UTSW 7 45,939,113 (GRCm39) missense probably damaging 1.00
R1344:Otog UTSW 7 45,924,039 (GRCm39) missense probably damaging 1.00
R1384:Otog UTSW 7 45,923,119 (GRCm39) splice site probably benign
R1418:Otog UTSW 7 45,924,039 (GRCm39) missense probably damaging 1.00
R1432:Otog UTSW 7 45,950,007 (GRCm39) missense probably damaging 1.00
R1479:Otog UTSW 7 45,945,402 (GRCm39) missense possibly damaging 0.75
R1521:Otog UTSW 7 45,908,688 (GRCm39) missense possibly damaging 0.71
R1589:Otog UTSW 7 45,933,332 (GRCm39) missense probably benign 0.18
R1671:Otog UTSW 7 45,911,210 (GRCm39) missense probably damaging 1.00
R1773:Otog UTSW 7 45,937,583 (GRCm39) missense probably benign 0.28
R1806:Otog UTSW 7 45,940,361 (GRCm39) critical splice acceptor site probably null
R1843:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R1873:Otog UTSW 7 45,918,767 (GRCm39) missense probably damaging 1.00
R1923:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R1927:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R2008:Otog UTSW 7 45,913,498 (GRCm39) missense probably benign 0.43
R2048:Otog UTSW 7 45,937,063 (GRCm39) missense probably damaging 1.00
R2131:Otog UTSW 7 45,899,524 (GRCm39) missense probably damaging 1.00
R2153:Otog UTSW 7 45,952,328 (GRCm39) missense probably damaging 1.00
R2240:Otog UTSW 7 45,890,453 (GRCm39) start codon destroyed probably null
R2278:Otog UTSW 7 45,949,468 (GRCm39) missense probably damaging 1.00
R2407:Otog UTSW 7 45,890,964 (GRCm39) missense probably benign 0.10
R2424:Otog UTSW 7 45,947,593 (GRCm39) nonsense probably null
R2513:Otog UTSW 7 45,955,014 (GRCm39) critical splice donor site probably null
R2863:Otog UTSW 7 45,918,730 (GRCm39) missense probably damaging 1.00
R3148:Otog UTSW 7 45,939,593 (GRCm39) missense probably damaging 1.00
R3732:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3732:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3733:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3734:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3855:Otog UTSW 7 45,923,184 (GRCm39) missense possibly damaging 0.65
R3880:Otog UTSW 7 45,937,445 (GRCm39) missense possibly damaging 0.93
R4081:Otog UTSW 7 45,937,723 (GRCm39) missense possibly damaging 0.92
R4349:Otog UTSW 7 45,923,613 (GRCm39) missense probably damaging 0.99
R4382:Otog UTSW 7 45,939,122 (GRCm39) missense probably damaging 1.00
R4392:Otog UTSW 7 45,934,548 (GRCm39) missense probably damaging 0.98
R4520:Otog UTSW 7 45,890,477 (GRCm39) unclassified probably benign
R4569:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R4580:Otog UTSW 7 45,937,225 (GRCm39) missense possibly damaging 0.78
R4672:Otog UTSW 7 45,939,210 (GRCm39) missense probably damaging 0.98
R4764:Otog UTSW 7 45,937,943 (GRCm39) missense probably benign 0.29
R4910:Otog UTSW 7 45,947,958 (GRCm39) missense probably damaging 1.00
R4910:Otog UTSW 7 45,913,486 (GRCm39) missense probably damaging 1.00
R4913:Otog UTSW 7 45,913,526 (GRCm39) missense probably benign 0.31
R4975:Otog UTSW 7 45,937,415 (GRCm39) missense probably benign 0.00
R4996:Otog UTSW 7 45,954,934 (GRCm39) nonsense probably null
R4996:Otog UTSW 7 45,948,030 (GRCm39) missense possibly damaging 0.51
R5116:Otog UTSW 7 45,923,191 (GRCm39) missense probably benign 0.34
R5138:Otog UTSW 7 45,899,430 (GRCm39) missense possibly damaging 0.61
R5169:Otog UTSW 7 45,947,572 (GRCm39) missense probably benign 0.06
R5239:Otog UTSW 7 45,936,859 (GRCm39) missense probably benign 0.15
R5277:Otog UTSW 7 45,896,045 (GRCm39) missense possibly damaging 0.89
R5287:Otog UTSW 7 45,918,753 (GRCm39) missense probably damaging 0.98
R5299:Otog UTSW 7 45,938,275 (GRCm39) missense probably benign 0.16
R5378:Otog UTSW 7 45,904,428 (GRCm39) missense probably damaging 1.00
R5382:Otog UTSW 7 45,898,428 (GRCm39) missense probably damaging 1.00
R5487:Otog UTSW 7 45,938,192 (GRCm39) missense probably benign 0.27
R5507:Otog UTSW 7 45,911,123 (GRCm39) missense probably damaging 1.00
R5517:Otog UTSW 7 45,923,995 (GRCm39) missense probably damaging 1.00
R5643:Otog UTSW 7 45,936,871 (GRCm39) missense probably damaging 1.00
R5757:Otog UTSW 7 45,890,545 (GRCm39) critical splice donor site probably null
R5910:Otog UTSW 7 45,948,022 (GRCm39) missense possibly damaging 0.94
R6019:Otog UTSW 7 45,938,374 (GRCm39) missense probably benign 0.00
R6150:Otog UTSW 7 45,913,483 (GRCm39) missense possibly damaging 0.82
R6225:Otog UTSW 7 45,898,458 (GRCm39) missense possibly damaging 0.67
R6271:Otog UTSW 7 45,901,464 (GRCm39) missense probably damaging 1.00
R6317:Otog UTSW 7 45,950,639 (GRCm39) missense probably damaging 1.00
R6454:Otog UTSW 7 45,955,241 (GRCm39) missense probably damaging 1.00
R6640:Otog UTSW 7 45,911,167 (GRCm39) missense possibly damaging 0.92
R6753:Otog UTSW 7 45,898,495 (GRCm39) missense probably benign 0.06
R6788:Otog UTSW 7 45,947,741 (GRCm39) missense probably damaging 1.00
R6859:Otog UTSW 7 45,923,205 (GRCm39) missense probably damaging 0.96
R7033:Otog UTSW 7 45,916,822 (GRCm39) critical splice donor site probably null
R7071:Otog UTSW 7 45,916,747 (GRCm39) missense probably damaging 1.00
R7084:Otog UTSW 7 45,947,990 (GRCm39) nonsense probably null
R7116:Otog UTSW 7 45,947,689 (GRCm39) missense probably damaging 0.99
R7202:Otog UTSW 7 45,937,474 (GRCm39) missense probably damaging 0.97
R7365:Otog UTSW 7 45,947,732 (GRCm39) missense probably damaging 1.00
R7468:Otog UTSW 7 45,913,543 (GRCm39) missense probably benign
R7475:Otog UTSW 7 45,916,700 (GRCm39) missense probably damaging 0.99
R7502:Otog UTSW 7 45,948,039 (GRCm39) missense probably damaging 1.00
R7558:Otog UTSW 7 45,952,584 (GRCm39) missense probably damaging 0.99
R7577:Otog UTSW 7 45,937,279 (GRCm39) missense possibly damaging 0.62
R7651:Otog UTSW 7 45,891,185 (GRCm39) missense probably benign 0.00
R7689:Otog UTSW 7 45,901,480 (GRCm39) missense probably damaging 1.00
R7806:Otog UTSW 7 45,935,200 (GRCm39) missense probably benign
R7933:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R8021:Otog UTSW 7 45,916,766 (GRCm39) missense probably damaging 0.98
R8082:Otog UTSW 7 45,939,143 (GRCm39) missense probably damaging 1.00
R8531:Otog UTSW 7 45,901,473 (GRCm39) missense probably damaging 0.99
R8772:Otog UTSW 7 45,934,352 (GRCm39) missense probably damaging 1.00
R8816:Otog UTSW 7 45,950,905 (GRCm39) missense possibly damaging 0.92
R8842:Otog UTSW 7 45,895,948 (GRCm39) missense probably damaging 1.00
R8987:Otog UTSW 7 45,936,878 (GRCm39) missense probably benign 0.43
R8988:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R9010:Otog UTSW 7 45,949,894 (GRCm39) missense probably benign 0.00
R9025:Otog UTSW 7 45,937,520 (GRCm39) missense probably benign 0.13
R9131:Otog UTSW 7 45,952,597 (GRCm39) nonsense probably null
R9179:Otog UTSW 7 45,937,885 (GRCm39) missense possibly damaging 0.65
R9334:Otog UTSW 7 45,909,353 (GRCm39) missense possibly damaging 0.95
R9365:Otog UTSW 7 45,920,688 (GRCm39) missense probably damaging 1.00
R9408:Otog UTSW 7 45,916,721 (GRCm39) missense possibly damaging 0.79
R9418:Otog UTSW 7 45,938,024 (GRCm39) missense probably benign 0.41
R9465:Otog UTSW 7 45,955,299 (GRCm39) missense possibly damaging 0.80
R9496:Otog UTSW 7 45,890,505 (GRCm39) missense unknown
R9632:Otog UTSW 7 45,915,143 (GRCm39) missense probably benign 0.27
R9656:Otog UTSW 7 45,959,567 (GRCm39) missense probably damaging 1.00
RF024:Otog UTSW 7 45,937,093 (GRCm39) missense probably damaging 1.00
X0062:Otog UTSW 7 45,909,345 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,939,164 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,923,962 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,912,276 (GRCm39) missense possibly damaging 0.80
Z1177:Otog UTSW 7 45,959,409 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGGGAGTCCCAACACCACTG -3'
(R):5'- CATGAGTGGCACTGTCAGACTGAG -3'

Sequencing Primer
(F):5'- AACACCACTGTCGCTTCC -3'
(R):5'- ACTGGCAACTCTGTAAGCTG -3'
Posted On 2013-10-16