Incidental Mutation 'R0844:Wdr82'
ID77295
Institutional Source Beutler Lab
Gene Symbol Wdr82
Ensembl Gene ENSMUSG00000020257
Gene NameWD repeat domain containing 82
Synonyms9430077D24Rik
MMRRC Submission 039023-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R0844 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106170928-106191139 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 106188581 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020490] [ENSMUST00000190564] [ENSMUST00000214444] [ENSMUST00000216761]
Predicted Effect probably benign
Transcript: ENSMUST00000020490
SMART Domains Protein: ENSMUSP00000020490
Gene: ENSMUSG00000020257

DomainStartEndE-ValueType
WD40 10 49 9.52e-6 SMART
WD40 96 135 3.47e-8 SMART
WD40 138 175 4.11e1 SMART
WD40 180 222 2.75e1 SMART
WD40 225 267 2.49e-1 SMART
WD40 270 308 1.33e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190564
Predicted Effect probably benign
Transcript: ENSMUST00000214444
Predicted Effect probably benign
Transcript: ENSMUST00000216761
Predicted Effect probably benign
Transcript: ENSMUST00000217532
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 100% (27/27)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TMEM113 (WDR82) is a component of the mammalian SET1A (MIM 611052)/SET1B (MIM 611055) histone H3-Lys4 methyltransferase complexes (Lee and Skalnik, 2005 [PubMed 16253997]; Lee et al., 2007 [PubMed 17355966]).[supplied by OMIM, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T C 12: 55,080,073 D2G possibly damaging Het
5330417C22Rik T C 3: 108,480,963 probably benign Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Asb2 T C 12: 103,325,546 H374R probably damaging Het
Clca4b A G 3: 144,916,771 I511T probably damaging Het
Cnmd G A 14: 79,641,951 T249I probably benign Het
Cyp4a12b T G 4: 115,432,524 M196R possibly damaging Het
Ddx60 T C 8: 61,987,361 Y1016H probably benign Het
Ero1l A G 14: 45,293,000 L325P probably damaging Het
Etv1 T C 12: 38,861,354 L393P probably damaging Het
Fdx1 G T 9: 51,948,609 D33E probably damaging Het
Gm156 C G 6: 129,775,793 K16N possibly damaging Het
Gpr180 T C 14: 118,157,947 C264R probably damaging Het
Grik2 A T 10: 49,101,115 M907K possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Mpdz A G 4: 81,421,194 probably benign Het
Myo9b C T 8: 71,290,475 S60L probably benign Het
Naxe A T 3: 88,058,408 V28E probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Otog T C 7: 46,287,828 S1654P possibly damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Spag17 A G 3: 100,004,785 T324A probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tbc1d12 G T 19: 38,837,071 R122L probably benign Het
Tmx4 A G 2: 134,600,008 probably null Het
Trnt1 A G 6: 106,774,503 D147G probably damaging Het
Trpm7 A T 2: 126,835,508 V463E probably damaging Het
Other mutations in Wdr82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdr82 APN 9 106184250 missense probably benign 0.19
IGL02135:Wdr82 APN 9 106171244 missense possibly damaging 0.94
IGL02604:Wdr82 APN 9 106183681 missense probably damaging 0.99
IGL02627:Wdr82 APN 9 106176687 missense possibly damaging 0.72
IGL03181:Wdr82 APN 9 106186415 missense probably benign 0.00
R5867:Wdr82 UTSW 9 106185304 missense probably benign 0.00
R5869:Wdr82 UTSW 9 106185304 missense probably benign 0.00
R7136:Wdr82 UTSW 9 106171333 missense probably benign 0.07
R7228:Wdr82 UTSW 9 106176672 missense probably benign
R7481:Wdr82 UTSW 9 106176666 missense probably damaging 0.98
Z1088:Wdr82 UTSW 9 106184800 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAACACAACCTTCTCATCTGGC -3'
(R):5'- AACTCATTAGAGCGATGGACAGCAC -3'

Sequencing Primer
(F):5'- CCTTAACACACTGTGTGACTG -3'
(R):5'- ATGGACAGCACATCCCTGG -3'
Posted On2013-10-16