Incidental Mutation 'R0845:Pde5a'
ID77311
Institutional Source Beutler Lab
Gene Symbol Pde5a
Ensembl Gene ENSMUSG00000053965
Gene Namephosphodiesterase 5A, cGMP-specific
SynonymsPDE5A1, Pde5
MMRRC Submission 039024-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R0845 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122728947-122859374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122729331 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 29 (D29G)
Ref Sequence ENSEMBL: ENSMUSP00000069011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066728] [ENSMUST00000200389]
PDB Structure
Solution Structure of cGMP-binding GAF domain of Phosphodiesterase 5 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000066728
AA Change: D29G

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069011
Gene: ENSMUSG00000053965
AA Change: D29G

DomainStartEndE-ValueType
Blast:GAF 64 152 4e-42 BLAST
GAF 154 314 2.23e-31 SMART
GAF 336 503 9.8e-28 SMART
HDc 600 768 8.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198314
Predicted Effect probably benign
Transcript: ENSMUST00000200389
SMART Domains Protein: ENSMUSP00000143042
Gene: ENSMUSG00000053965

DomainStartEndE-ValueType
Blast:GAF 32 120 3e-42 BLAST
GAF 122 282 1.1e-33 SMART
GAF 304 471 4.7e-30 SMART
HDc 568 736 4.4e-11 SMART
Meta Mutation Damage Score 0.1042 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.2%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cGMP-binding, cGMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family. This phosphodiesterase specifically hydrolyzes cGMP to 5'-GMP. It is involved in the regulation of intracellular concentrations of cyclic nucleotides and is important for smooth muscle relaxation in the cardiovascular system. Alternative splicing of this gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 G T 7: 28,913,430 A116E probably damaging Het
Adamtsl3 A G 7: 82,575,996 I338V probably damaging Het
Akap13 T G 7: 75,725,380 V1920G probably damaging Het
Atp6v0d2 C T 4: 19,880,055 V281I probably benign Het
AW209491 T G 13: 14,637,022 S153R probably damaging Het
Brd7 A T 8: 88,342,767 Y433* probably null Het
Bub1b A G 2: 118,609,976 H187R probably damaging Het
Clstn2 T A 9: 97,570,628 Q242L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Comt T C 16: 18,407,961 Y225C probably damaging Het
Ctbs T A 3: 146,455,107 L143Q probably damaging Het
Ctsw T C 19: 5,465,461 probably benign Het
Dhx16 T C 17: 35,883,302 I435T probably damaging Het
Dmxl1 T C 18: 49,893,402 F1859S probably damaging Het
Glud1 A G 14: 34,329,394 probably benign Het
Gm8220 A G 14: 44,286,791 H71R probably damaging Het
Gnb1l A G 16: 18,552,473 E238G probably benign Het
H2-T23 T C 17: 36,030,583 H332R probably benign Het
Itga5 T A 15: 103,350,769 T744S probably benign Het
Larp1 A G 11: 58,047,750 E453G probably benign Het
Lrrk2 C A 15: 91,755,962 P1570Q probably benign Het
Lrsam1 C T 2: 32,953,443 R150Q possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Msln T C 17: 25,750,796 Y320C probably damaging Het
Mtbp T C 15: 55,563,090 probably null Het
Muc5b A G 7: 141,850,446 probably null Het
Mup21 A G 4: 62,150,310 S40P probably damaging Het
Myh8 T C 11: 67,286,264 V414A probably damaging Het
P2rx5 T C 11: 73,165,574 I108T probably damaging Het
Paqr9 T C 9: 95,560,740 L261P probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pih1d1 A G 7: 45,159,682 D230G probably benign Het
Pik3r1 G T 13: 101,686,264 D643E probably benign Het
Rnf207 A G 4: 152,312,064 probably benign Het
Sept9 T C 11: 117,356,325 probably benign Het
Serinc1 A T 10: 57,525,383 S105T probably benign Het
Slc8a1 A G 17: 81,437,748 S676P probably benign Het
Srrm4 C T 5: 116,444,885 probably null Het
Tcn2 T A 11: 3,919,349 D391V probably benign Het
Tmem131 T C 1: 36,816,222 T808A probably damaging Het
Ubqln3 G T 7: 104,142,068 Q272K probably damaging Het
Unc79 T C 12: 103,173,444 probably benign Het
Xpo6 G A 7: 126,129,543 probably benign Het
Zfp667 A T 7: 6,306,092 K586N possibly damaging Het
Other mutations in Pde5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pde5a APN 3 122794357 missense probably damaging 1.00
IGL00945:Pde5a APN 3 122835642 critical splice donor site probably null
IGL01395:Pde5a APN 3 122817955 missense probably benign 0.40
IGL01872:Pde5a APN 3 122794369 critical splice donor site probably null
IGL01947:Pde5a APN 3 122835610 missense probably damaging 1.00
IGL02033:Pde5a APN 3 122803061 missense possibly damaging 0.51
IGL02209:Pde5a APN 3 122825015 splice site probably benign
IGL02220:Pde5a APN 3 122748382 missense probably benign 0.05
IGL02301:Pde5a APN 3 122760885 missense probably damaging 1.00
IGL02748:Pde5a APN 3 122760892 missense probably damaging 0.99
R0009:Pde5a UTSW 3 122824902 splice site probably benign
R0031:Pde5a UTSW 3 122803055 missense probably benign 0.00
R0119:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0390:Pde5a UTSW 3 122835583 missense probably damaging 1.00
R0481:Pde5a UTSW 3 122818077 splice site probably benign
R0499:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0657:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0908:Pde5a UTSW 3 122779001 missense probably benign 0.01
R1147:Pde5a UTSW 3 122794313 missense probably damaging 1.00
R1147:Pde5a UTSW 3 122794313 missense probably damaging 1.00
R1553:Pde5a UTSW 3 122778936 missense probably benign 0.14
R1728:Pde5a UTSW 3 122748240 missense probably damaging 1.00
R1744:Pde5a UTSW 3 122747897 missense probably damaging 0.97
R1774:Pde5a UTSW 3 122729364 missense probably benign 0.01
R1784:Pde5a UTSW 3 122748240 missense probably damaging 1.00
R2437:Pde5a UTSW 3 122843053 missense probably damaging 1.00
R2844:Pde5a UTSW 3 122851708 missense probably damaging 1.00
R2897:Pde5a UTSW 3 122779002 missense probably benign 0.03
R2936:Pde5a UTSW 3 122794319 missense probably damaging 0.97
R3160:Pde5a UTSW 3 122781628 nonsense probably null
R3162:Pde5a UTSW 3 122781628 nonsense probably null
R3704:Pde5a UTSW 3 122779019 missense probably benign 0.00
R3847:Pde5a UTSW 3 122803160 missense probably damaging 0.98
R3932:Pde5a UTSW 3 122760896 missense probably damaging 0.98
R4387:Pde5a UTSW 3 122729352 missense probably benign 0.00
R4613:Pde5a UTSW 3 122823093 missense probably damaging 1.00
R4676:Pde5a UTSW 3 122747893 missense possibly damaging 0.67
R5034:Pde5a UTSW 3 122852586 missense probably damaging 1.00
R5034:Pde5a UTSW 3 122852587 missense probably damaging 1.00
R5358:Pde5a UTSW 3 122748176 missense probably damaging 1.00
R5394:Pde5a UTSW 3 122818009 missense probably damaging 1.00
R5502:Pde5a UTSW 3 122803032 missense probably damaging 1.00
R5821:Pde5a UTSW 3 122817955 missense probably benign 0.40
R5932:Pde5a UTSW 3 122841044 missense probably benign 0.01
R6063:Pde5a UTSW 3 122824925 missense probably benign 0.23
R6190:Pde5a UTSW 3 122729307 missense probably benign 0.28
R6815:Pde5a UTSW 3 122824924 missense probably benign 0.01
R6940:Pde5a UTSW 3 122779032 missense possibly damaging 0.53
R7274:Pde5a UTSW 3 122855246 nonsense probably null
R7337:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R7384:Pde5a UTSW 3 122825000 missense probably damaging 1.00
R7480:Pde5a UTSW 3 122803148 missense possibly damaging 0.50
R7508:Pde5a UTSW 3 122818030 missense probably damaging 1.00
R7522:Pde5a UTSW 3 122840999 nonsense probably null
R7623:Pde5a UTSW 3 122774601 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAATTGCAAATCCACCCACTGTC -3'
(R):5'- CCGAGAAGCTACTTCCGAAGCAAAG -3'

Sequencing Primer
(F):5'- TGGCTTCGCTGAGACACTG -3'
(R):5'- TTCCGAAGCAAAGGGCCTG -3'
Posted On2013-10-16