Incidental Mutation 'R0845:Srrm4'
ID77316
Institutional Source Beutler Lab
Gene Symbol Srrm4
Ensembl Gene ENSMUSG00000063919
Gene Nameserine/arginine repetitive matrix 4
SynonymsB230202K19Rik, fp, bv, nSR100, 1500001A10Rik, flopsy
MMRRC Submission 039024-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R0845 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location116439275-116591817 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 116444885 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076124] [ENSMUST00000076124] [ENSMUST00000076124] [ENSMUST00000076124] [ENSMUST00000139425] [ENSMUST00000139425] [ENSMUST00000139425] [ENSMUST00000139425] [ENSMUST00000139425] [ENSMUST00000139425] [ENSMUST00000139425] [ENSMUST00000139425]
Predicted Effect probably null
Transcript: ENSMUST00000076124
SMART Domains Protein: ENSMUSP00000075488
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
low complexity region 102 202 N/A INTRINSIC
low complexity region 289 299 N/A INTRINSIC
Pfam:SRRM_C 455 518 4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076124
SMART Domains Protein: ENSMUSP00000075488
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
low complexity region 102 202 N/A INTRINSIC
low complexity region 289 299 N/A INTRINSIC
Pfam:SRRM_C 455 518 4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076124
SMART Domains Protein: ENSMUSP00000075488
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
low complexity region 102 202 N/A INTRINSIC
low complexity region 289 299 N/A INTRINSIC
Pfam:SRRM_C 455 518 4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076124
SMART Domains Protein: ENSMUSP00000075488
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
low complexity region 102 202 N/A INTRINSIC
low complexity region 289 299 N/A INTRINSIC
Pfam:SRRM_C 455 518 4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133548
Predicted Effect probably null
Transcript: ENSMUST00000139425
SMART Domains Protein: ENSMUSP00000144367
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
Pfam:SRRM_C 1 30 1.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139425
SMART Domains Protein: ENSMUSP00000144367
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
Pfam:SRRM_C 1 30 1.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139425
SMART Domains Protein: ENSMUSP00000144367
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
Pfam:SRRM_C 1 30 1.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139425
SMART Domains Protein: ENSMUSP00000144367
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
Pfam:SRRM_C 1 30 1.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139425
SMART Domains Protein: ENSMUSP00000144367
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
Pfam:SRRM_C 1 30 1.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139425
SMART Domains Protein: ENSMUSP00000144367
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
Pfam:SRRM_C 1 30 1.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139425
SMART Domains Protein: ENSMUSP00000144367
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
Pfam:SRRM_C 1 30 1.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139425
SMART Domains Protein: ENSMUSP00000144367
Gene: ENSMUSG00000063919

DomainStartEndE-ValueType
Pfam:SRRM_C 1 30 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150127
Predicted Effect probably benign
Transcript: ENSMUST00000222119
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.2%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SRRM4 promotes alternative splicing and inclusion of neural-specific exons in target mRNAs (Calarco et al., 2009 [PubMed 19737518]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Most homozygous null mice die neonatally with respiratory defects while survivors show tremors, head tilt, circling, premature neurogenesis, altered neurite outgrowth, cortical layering and axon guidance. Homozygotes for a spontaneous deletion show inner ear hair cell, balance and hearing defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 G T 7: 28,913,430 A116E probably damaging Het
Adamtsl3 A G 7: 82,575,996 I338V probably damaging Het
Akap13 T G 7: 75,725,380 V1920G probably damaging Het
Atp6v0d2 C T 4: 19,880,055 V281I probably benign Het
AW209491 T G 13: 14,637,022 S153R probably damaging Het
Brd7 A T 8: 88,342,767 Y433* probably null Het
Bub1b A G 2: 118,609,976 H187R probably damaging Het
Clstn2 T A 9: 97,570,628 Q242L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Comt T C 16: 18,407,961 Y225C probably damaging Het
Ctbs T A 3: 146,455,107 L143Q probably damaging Het
Ctsw T C 19: 5,465,461 probably benign Het
Dhx16 T C 17: 35,883,302 I435T probably damaging Het
Dmxl1 T C 18: 49,893,402 F1859S probably damaging Het
Glud1 A G 14: 34,329,394 probably benign Het
Gm8220 A G 14: 44,286,791 H71R probably damaging Het
Gnb1l A G 16: 18,552,473 E238G probably benign Het
H2-T23 T C 17: 36,030,583 H332R probably benign Het
Itga5 T A 15: 103,350,769 T744S probably benign Het
Larp1 A G 11: 58,047,750 E453G probably benign Het
Lrrk2 C A 15: 91,755,962 P1570Q probably benign Het
Lrsam1 C T 2: 32,953,443 R150Q possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Msln T C 17: 25,750,796 Y320C probably damaging Het
Mtbp T C 15: 55,563,090 probably null Het
Muc5b A G 7: 141,850,446 probably null Het
Mup21 A G 4: 62,150,310 S40P probably damaging Het
Myh8 T C 11: 67,286,264 V414A probably damaging Het
P2rx5 T C 11: 73,165,574 I108T probably damaging Het
Paqr9 T C 9: 95,560,740 L261P probably damaging Het
Pde5a A G 3: 122,729,331 D29G probably benign Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pih1d1 A G 7: 45,159,682 D230G probably benign Het
Pik3r1 G T 13: 101,686,264 D643E probably benign Het
Rnf207 A G 4: 152,312,064 probably benign Het
Sept9 T C 11: 117,356,325 probably benign Het
Serinc1 A T 10: 57,525,383 S105T probably benign Het
Slc8a1 A G 17: 81,437,748 S676P probably benign Het
Tcn2 T A 11: 3,919,349 D391V probably benign Het
Tmem131 T C 1: 36,816,222 T808A probably damaging Het
Ubqln3 G T 7: 104,142,068 Q272K probably damaging Het
Unc79 T C 12: 103,173,444 probably benign Het
Xpo6 G A 7: 126,129,543 probably benign Het
Zfp667 A T 7: 6,306,092 K586N possibly damaging Het
Other mutations in Srrm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Srrm4 APN 5 116446557 missense possibly damaging 0.86
IGL01291:Srrm4 APN 5 116467569 missense unknown
IGL01873:Srrm4 APN 5 116591468 utr 5 prime probably benign
IGL02553:Srrm4 APN 5 116444565 unclassified probably benign
IGL03090:Srrm4 APN 5 116449584 utr 3 prime probably benign
ANU05:Srrm4 UTSW 5 116467569 missense unknown
R0285:Srrm4 UTSW 5 116467789 unclassified probably benign
R0386:Srrm4 UTSW 5 116482378 splice site probably benign
R0825:Srrm4 UTSW 5 116453713 missense unknown
R1615:Srrm4 UTSW 5 116447300 unclassified probably benign
R1874:Srrm4 UTSW 5 116453506 utr 3 prime probably benign
R2037:Srrm4 UTSW 5 116467828 unclassified probably benign
R3522:Srrm4 UTSW 5 116446544 start codon destroyed probably null
R3968:Srrm4 UTSW 5 116444744 unclassified probably benign
R4507:Srrm4 UTSW 5 116446553 missense probably damaging 0.98
R4771:Srrm4 UTSW 5 116475175 critical splice donor site probably null
R4815:Srrm4 UTSW 5 116475190 missense unknown
R4817:Srrm4 UTSW 5 116477134 missense unknown
R5383:Srrm4 UTSW 5 116471260 unclassified probably benign
R5620:Srrm4 UTSW 5 116449613 utr 3 prime probably benign
R5639:Srrm4 UTSW 5 116591359 missense unknown
R6497:Srrm4 UTSW 5 116467491 missense unknown
R7029:Srrm4 UTSW 5 116444792 unclassified probably benign
R7166:Srrm4 UTSW 5 116471242 missense unknown
R7514:Srrm4 UTSW 5 116446511 missense probably damaging 0.98
Z1176:Srrm4 UTSW 5 116453419 nonsense probably null
Z1177:Srrm4 UTSW 5 116453636 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCCGGCTCCGGGAGTAACTG -3'
(R):5'- TCCCTGCATCTAGGCATCCATGAG -3'

Sequencing Primer
(F):5'- GTAACTGCGGCTAGGGG -3'
(R):5'- aatcaaagtggcaacgcag -3'
Posted On2013-10-16