Incidental Mutation 'R0845:Adamtsl3'
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
MMRRC Submission 039024-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0845 (G1)
Quality Score225
Status Validated
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82575996 bp
Amino Acid Change Isoleucine to Valine at position 338 (I338V)
Ref Sequence ENSEMBL: ENSMUSP00000133337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect probably damaging
Transcript: ENSMUST00000173287
AA Change: I1264V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: I1264V

signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173828
AA Change: I338V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469
AA Change: I338V

signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Meta Mutation Damage Score 0.3059 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.2%
Validation Efficiency 96% (45/47)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 G T 7: 28,913,430 A116E probably damaging Het
Akap13 T G 7: 75,725,380 V1920G probably damaging Het
Atp6v0d2 C T 4: 19,880,055 V281I probably benign Het
AW209491 T G 13: 14,637,022 S153R probably damaging Het
Brd7 A T 8: 88,342,767 Y433* probably null Het
Bub1b A G 2: 118,609,976 H187R probably damaging Het
Clstn2 T A 9: 97,570,628 Q242L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Comt T C 16: 18,407,961 Y225C probably damaging Het
Ctbs T A 3: 146,455,107 L143Q probably damaging Het
Ctsw T C 19: 5,465,461 probably benign Het
Dhx16 T C 17: 35,883,302 I435T probably damaging Het
Dmxl1 T C 18: 49,893,402 F1859S probably damaging Het
Glud1 A G 14: 34,329,394 probably benign Het
Gm8220 A G 14: 44,286,791 H71R probably damaging Het
Gnb1l A G 16: 18,552,473 E238G probably benign Het
H2-T23 T C 17: 36,030,583 H332R probably benign Het
Itga5 T A 15: 103,350,769 T744S probably benign Het
Larp1 A G 11: 58,047,750 E453G probably benign Het
Lrrk2 C A 15: 91,755,962 P1570Q probably benign Het
Lrsam1 C T 2: 32,953,443 R150Q possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Msln T C 17: 25,750,796 Y320C probably damaging Het
Mtbp T C 15: 55,563,090 probably null Het
Muc5b A G 7: 141,850,446 probably null Het
Mup21 A G 4: 62,150,310 S40P probably damaging Het
Myh8 T C 11: 67,286,264 V414A probably damaging Het
P2rx5 T C 11: 73,165,574 I108T probably damaging Het
Paqr9 T C 9: 95,560,740 L261P probably damaging Het
Pde5a A G 3: 122,729,331 D29G probably benign Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pih1d1 A G 7: 45,159,682 D230G probably benign Het
Pik3r1 G T 13: 101,686,264 D643E probably benign Het
Rnf207 A G 4: 152,312,064 probably benign Het
Sept9 T C 11: 117,356,325 probably benign Het
Serinc1 A T 10: 57,525,383 S105T probably benign Het
Slc8a1 A G 17: 81,437,748 S676P probably benign Het
Srrm4 C T 5: 116,444,885 probably null Het
Tcn2 T A 11: 3,919,349 D391V probably benign Het
Tmem131 T C 1: 36,816,222 T808A probably damaging Het
Ubqln3 G T 7: 104,142,068 Q272K probably damaging Het
Unc79 T C 12: 103,173,444 probably benign Het
Xpo6 G A 7: 126,129,543 probably benign Het
Zfp667 A T 7: 6,306,092 K586N possibly damaging Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2448:Adamtsl3 UTSW 7 82499748 missense probably damaging 1.00
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R4960:Adamtsl3 UTSW 7 82566977 missense probably damaging 0.99
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5523:Adamtsl3 UTSW 7 82574442 missense possibly damaging 0.86
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5782:Adamtsl3 UTSW 7 82540286 splice site probably null
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R6982:Adamtsl3 UTSW 7 82515063 missense probably damaging 1.00
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7506:Adamtsl3 UTSW 7 82514978 missense probably damaging 1.00
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7575:Adamtsl3 UTSW 7 82574548 missense possibly damaging 0.85
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7617:Adamtsl3 UTSW 7 82556846 splice site probably null
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7721:Adamtsl3 UTSW 7 82606520 missense possibly damaging 0.62
R7784:Adamtsl3 UTSW 7 82573989 missense probably damaging 1.00
R7858:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
R8109:Adamtsl3 UTSW 7 82602279 missense possibly damaging 0.94
R8125:Adamtsl3 UTSW 7 82450333 splice site probably null
R8211:Adamtsl3 UTSW 7 82523163 missense probably damaging 1.00
R8348:Adamtsl3 UTSW 7 82603799 missense possibly damaging 0.89
R8360:Adamtsl3 UTSW 7 82547979 missense probably damaging 1.00
R8448:Adamtsl3 UTSW 7 82603799 missense possibly damaging 0.89
R8465:Adamtsl3 UTSW 7 82598122 missense probably benign 0.43
R8547:Adamtsl3 UTSW 7 82428413 missense probably damaging 1.00
R8551:Adamtsl3 UTSW 7 82540470 missense probably benign 0.34
RF005:Adamtsl3 UTSW 7 82612395 missense
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gccaagcgtcaaactcattc -3'
Posted On2013-10-16