Mutagenetix > Incidental Mutations

Incidental Mutation 'R0845:Adamtsl3'

77322

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl3

Ensembl Gene

ENSMUSG00000070469

Gene Name

ADAMTS-like 3

Synonyms

punctin-2, 9230119C12Rik

MMRRC Submission

039024-MU

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0845 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82335694-82614450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 82575996 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 338 (I338V)

Ref Sequence

ENSEMBL: ENSMUSP00000133337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]

Predicted Effect

probably damaging
Transcript: ENSMUST00000173287
AA Change: I1264V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: I1264V

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	90	136	6.43e-8	SMART
TSP1	355	414	1.59e-1	SMART
TSP1	433	492	3.72e-4	SMART
TSP1	494	547	4.28e-4	SMART
TSP1	579	638	1.85e-2	SMART
TSP1	660	717	1.75e-2	SMART
TSP1	719	773	3.45e-8	SMART
TSP1	775	833	3.67e-3	SMART
TSP1	836	894	8.99e-2	SMART
IGc2	938	1002	7.59e-4	SMART
IG	1213	1296	4.87e0	SMART
IGc2	1326	1388	1.01e-13	SMART
TSP1	1441	1498	1.95e-2	SMART
TSP1	1500	1559	6.76e-2	SMART
TSP1	1616	1666	3.84e-1	SMART
Pfam:PLAC	1674	1704	2.4e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173828
AA Change: I338V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469
AA Change: I338V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Blast:IG	22	79	1e-26	BLAST
SCOP:d1biha4	27	77	2e-5	SMART
IG	283	366	4.87e0	SMART
IGc2	396	458	1.01e-13	SMART
TSP1	511	568	1.95e-2	SMART
TSP1	570	629	6.76e-2	SMART
TSP1	686	736	3.84e-1	SMART

Meta Mutation Damage Score

0.3059

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 93.2%

Validation Efficiency

96% (45/47)

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn4	G	T	7: 28,913,430	A116E	probably damaging	Het
Akap13	T	G	7: 75,725,380	V1920G	probably damaging	Het
Atp6v0d2	C	T	4: 19,880,055	V281I	probably benign	Het
AW209491	T	G	13: 14,637,022	S153R	probably damaging	Het
Brd7	A	T	8: 88,342,767	Y433*	probably null	Het
Bub1b	A	G	2: 118,609,976	H187R	probably damaging	Het
Clstn2	T	A	9: 97,570,628	Q242L	probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Comt	T	C	16: 18,407,961	Y225C	probably damaging	Het
Ctbs	T	A	3: 146,455,107	L143Q	probably damaging	Het
Ctsw	T	C	19: 5,465,461		probably benign	Het
Dhx16	T	C	17: 35,883,302	I435T	probably damaging	Het
Dmxl1	T	C	18: 49,893,402	F1859S	probably damaging	Het
Glud1	A	G	14: 34,329,394		probably benign	Het
Gm8220	A	G	14: 44,286,791	H71R	probably damaging	Het
Gnb1l	A	G	16: 18,552,473	E238G	probably benign	Het
H2-T23	T	C	17: 36,030,583	H332R	probably benign	Het
Itga5	T	A	15: 103,350,769	T744S	probably benign	Het
Larp1	A	G	11: 58,047,750	E453G	probably benign	Het
Lrrk2	C	A	15: 91,755,962	P1570Q	probably benign	Het
Lrsam1	C	T	2: 32,953,443	R150Q	possibly damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Msln	T	C	17: 25,750,796	Y320C	probably damaging	Het
Mtbp	T	C	15: 55,563,090		probably null	Het
Muc5b	A	G	7: 141,850,446		probably null	Het
Mup21	A	G	4: 62,150,310	S40P	probably damaging	Het
Myh8	T	C	11: 67,286,264	V414A	probably damaging	Het
P2rx5	T	C	11: 73,165,574	I108T	probably damaging	Het
Paqr9	T	C	9: 95,560,740	L261P	probably damaging	Het
Pde5a	A	G	3: 122,729,331	D29G	probably benign	Het
Phf11d	A	T	14: 59,353,344	M188K	possibly damaging	Het
Pih1d1	A	G	7: 45,159,682	D230G	probably benign	Het
Pik3r1	G	T	13: 101,686,264	D643E	probably benign	Het
Rnf207	A	G	4: 152,312,064		probably benign	Het
Sept9	T	C	11: 117,356,325		probably benign	Het
Serinc1	A	T	10: 57,525,383	S105T	probably benign	Het
Slc8a1	A	G	17: 81,437,748	S676P	probably benign	Het
Srrm4	C	T	5: 116,444,885		probably null	Het
Tcn2	T	A	11: 3,919,349	D391V	probably benign	Het
Tmem131	T	C	1: 36,816,222	T808A	probably damaging	Het
Ubqln3	G	T	7: 104,142,068	Q272K	probably damaging	Het
Unc79	T	C	12: 103,173,444		probably benign	Het
Xpo6	G	A	7: 126,129,543		probably benign	Het
Zfp667	A	T	7: 6,306,092	K586N	possibly damaging	Het

Other mutations in Adamtsl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01549:Adamtsl3	APN	7	82612448	missense	probably damaging	1.00
IGL01936:Adamtsl3	APN	7	82595371	missense	possibly damaging	0.93
IGL02819:Adamtsl3	APN	7	82574121	missense	probably damaging	0.99
P0012:Adamtsl3	UTSW	7	82574257	missense	probably benign	0.27
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0180:Adamtsl3	UTSW	7	82575990	missense	probably benign	0.00
R0270:Adamtsl3	UTSW	7	82556824	missense	probably damaging	1.00
R0295:Adamtsl3	UTSW	7	82548005	critical splice donor site	probably null
R0329:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0330:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0548:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R0611:Adamtsl3	UTSW	7	82528912	missense	probably damaging	1.00
R0671:Adamtsl3	UTSW	7	82523182	missense	probably damaging	1.00
R0711:Adamtsl3	UTSW	7	82465699	intron	probably benign
R1119:Adamtsl3	UTSW	7	82540317	missense	probably damaging	0.96
R1458:Adamtsl3	UTSW	7	82523320	missense	probably damaging	1.00
R1644:Adamtsl3	UTSW	7	82450090	missense	possibly damaging	0.87
R1691:Adamtsl3	UTSW	7	82499606	missense	probably damaging	1.00
R1838:Adamtsl3	UTSW	7	82493373	missense	probably damaging	1.00
R2131:Adamtsl3	UTSW	7	82578594	missense	probably damaging	1.00
R2245:Adamtsl3	UTSW	7	82450100	missense	probably damaging	1.00
R2274:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2275:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2448:Adamtsl3	UTSW	7	82499748	missense	probably damaging	1.00
R3725:Adamtsl3	UTSW	7	82612404	missense	possibly damaging	0.80
R3757:Adamtsl3	UTSW	7	82337207	missense	probably benign	0.01
R3821:Adamtsl3	UTSW	7	82606479	splice site	probably benign
R4618:Adamtsl3	UTSW	7	82606520	missense	probably benign	0.41
R4842:Adamtsl3	UTSW	7	82528861	missense	probably damaging	1.00
R4887:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4888:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4925:Adamtsl3	UTSW	7	82602299	critical splice donor site	probably null
R4960:Adamtsl3	UTSW	7	82566977	missense	probably damaging	0.99
R5026:Adamtsl3	UTSW	7	82576054	missense	probably benign	0.07
R5152:Adamtsl3	UTSW	7	82574544	missense	probably benign	0.11
R5198:Adamtsl3	UTSW	7	82611798	missense	possibly damaging	0.63
R5244:Adamtsl3	UTSW	7	82598069	missense	probably benign	0.02
R5281:Adamtsl3	UTSW	7	82528934	missense	probably damaging	1.00
R5323:Adamtsl3	UTSW	7	82557061	missense	probably damaging	1.00
R5523:Adamtsl3	UTSW	7	82574442	missense	possibly damaging	0.86
R5602:Adamtsl3	UTSW	7	82557239	missense	possibly damaging	0.89
R5638:Adamtsl3	UTSW	7	82611750	missense	probably damaging	0.99
R5682:Adamtsl3	UTSW	7	82606550	missense	probably damaging	0.99
R5782:Adamtsl3	UTSW	7	82540286	splice site	probably null
R5946:Adamtsl3	UTSW	7	82576057	missense	probably damaging	0.98
R6091:Adamtsl3	UTSW	7	82465621	missense	probably damaging	1.00
R6258:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R6500:Adamtsl3	UTSW	7	82578610	missense	probably benign	0.00
R6765:Adamtsl3	UTSW	7	82567024	missense	possibly damaging	0.60
R6785:Adamtsl3	UTSW	7	82522004	missense	probably damaging	0.99
R6982:Adamtsl3	UTSW	7	82515063	missense	probably damaging	1.00
R7109:Adamtsl3	UTSW	7	82611861	missense
R7341:Adamtsl3	UTSW	7	82556874	missense	probably damaging	1.00
R7402:Adamtsl3	UTSW	7	82578617	missense	probably damaging	0.96
R7506:Adamtsl3	UTSW	7	82514978	missense	probably damaging	1.00
R7549:Adamtsl3	UTSW	7	82573909	missense	probably damaging	1.00
R7575:Adamtsl3	UTSW	7	82574548	missense	possibly damaging	0.85
R7592:Adamtsl3	UTSW	7	82337251	missense	probably benign	0.00
R7617:Adamtsl3	UTSW	7	82556846	splice site	probably null
R7654:Adamtsl3	UTSW	7	82574494	missense	probably benign
R7721:Adamtsl3	UTSW	7	82606520	missense	possibly damaging	0.62
R7784:Adamtsl3	UTSW	7	82573989	missense	probably damaging	1.00
R7858:Adamtsl3	UTSW	7	82450163	missense	probably damaging	1.00
R8109:Adamtsl3	UTSW	7	82602279	missense	possibly damaging	0.94
R8125:Adamtsl3	UTSW	7	82450333	splice site	probably null
R8211:Adamtsl3	UTSW	7	82523163	missense	probably damaging	1.00
R8348:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
R8360:Adamtsl3	UTSW	7	82547979	missense	probably damaging	1.00
R8448:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
R8465:Adamtsl3	UTSW	7	82598122	missense	probably benign	0.43
R8547:Adamtsl3	UTSW	7	82428413	missense	probably damaging	1.00
R8551:Adamtsl3	UTSW	7	82540470	missense	probably benign	0.34
RF005:Adamtsl3	UTSW	7	82612395	missense
X0003:Adamtsl3	UTSW	7	82611759	nonsense	probably null
X0063:Adamtsl3	UTSW	7	82574157	missense	probably benign	0.25
Z1088:Adamtsl3	UTSW	7	82499714	missense	probably damaging	1.00
Z1088:Adamtsl3	UTSW	7	82540325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTCCTCTAGGCTGAGAACTGGAC -3'
(R):5'- AGGATTAGCCCGTGTGCCATTG -3'

Sequencing Primer
(F):5'- TGGACATGATCACCATTAGGACTC -3'
(R):5'- gccaagcgtcaaactcattc -3'

Posted On

2013-10-16