Incidental Mutation 'R0845:Ubqln3'
ID 77323
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 039024-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R0845 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103791275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 272 (Q272K)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: Q272K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: Q272K

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.3905 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.2%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 G T 7: 28,612,855 (GRCm39) A116E probably damaging Het
Adamtsl3 A G 7: 82,225,204 (GRCm39) I338V probably damaging Het
Akap13 T G 7: 75,375,128 (GRCm39) V1920G probably damaging Het
Atp6v0d2 C T 4: 19,880,055 (GRCm39) V281I probably benign Het
AW209491 T G 13: 14,811,607 (GRCm39) S153R probably damaging Het
Brd7 A T 8: 89,069,395 (GRCm39) Y433* probably null Het
Bub1b A G 2: 118,440,457 (GRCm39) H187R probably damaging Het
Clstn2 T A 9: 97,452,681 (GRCm39) Q242L probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Comt T C 16: 18,226,711 (GRCm39) Y225C probably damaging Het
Ctbs T A 3: 146,160,862 (GRCm39) L143Q probably damaging Het
Ctsw T C 19: 5,515,489 (GRCm39) probably benign Het
Dhx16 T C 17: 36,194,194 (GRCm39) I435T probably damaging Het
Dmxl1 T C 18: 50,026,469 (GRCm39) F1859S probably damaging Het
Glud1 A G 14: 34,051,351 (GRCm39) probably benign Het
Gm8220 A G 14: 44,524,248 (GRCm39) H71R probably damaging Het
Gnb1l A G 16: 18,371,223 (GRCm39) E238G probably benign Het
H2-T23 T C 17: 36,341,475 (GRCm39) H332R probably benign Het
Itga5 T A 15: 103,259,196 (GRCm39) T744S probably benign Het
Larp1 A G 11: 57,938,576 (GRCm39) E453G probably benign Het
Lrrk2 C A 15: 91,640,165 (GRCm39) P1570Q probably benign Het
Lrsam1 C T 2: 32,843,455 (GRCm39) R150Q possibly damaging Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Msln T C 17: 25,969,770 (GRCm39) Y320C probably damaging Het
Mtbp T C 15: 55,426,486 (GRCm39) probably null Het
Muc5b A G 7: 141,404,183 (GRCm39) probably null Het
Mup21 A G 4: 62,068,547 (GRCm39) S40P probably damaging Het
Myh8 T C 11: 67,177,090 (GRCm39) V414A probably damaging Het
P2rx5 T C 11: 73,056,400 (GRCm39) I108T probably damaging Het
Paqr9 T C 9: 95,442,793 (GRCm39) L261P probably damaging Het
Pde5a A G 3: 122,522,980 (GRCm39) D29G probably benign Het
Phf11d A T 14: 59,590,793 (GRCm39) M188K possibly damaging Het
Pih1d1 A G 7: 44,809,106 (GRCm39) D230G probably benign Het
Pik3r1 G T 13: 101,822,772 (GRCm39) D643E probably benign Het
Rnf207 A G 4: 152,396,521 (GRCm39) probably benign Het
Septin9 T C 11: 117,247,151 (GRCm39) probably benign Het
Serinc1 A T 10: 57,401,479 (GRCm39) S105T probably benign Het
Slc8a1 A G 17: 81,745,177 (GRCm39) S676P probably benign Het
Srrm4 C T 5: 116,582,944 (GRCm39) probably null Het
Tcn2 T A 11: 3,869,349 (GRCm39) D391V probably benign Het
Tmem131 T C 1: 36,855,303 (GRCm39) T808A probably damaging Het
Unc79 T C 12: 103,139,703 (GRCm39) probably benign Het
Xpo6 G A 7: 125,728,715 (GRCm39) probably benign Het
Zfp667 A T 7: 6,309,091 (GRCm39) K586N possibly damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTTACCCAGAAAGCTTGGAAGCC -3'
(R):5'- TCTTGACAATCCTCACATGCAGCAC -3'

Sequencing Primer
(F):5'- GGAAGCCTATTTCTATTTTCAGATGC -3'
(R):5'- CAGAACCCTGAGATTGGTCATATTC -3'
Posted On 2013-10-16