Incidental Mutation 'R0845:Ubqln3'
ID77323
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Nameubiquilin 3
Synonyms4933400K24Rik
MMRRC Submission 039024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0845 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104140623-104143279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104142068 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 272 (Q272K)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: Q272K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: Q272K

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.3905 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.2%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 G T 7: 28,913,430 A116E probably damaging Het
Adamtsl3 A G 7: 82,575,996 I338V probably damaging Het
Akap13 T G 7: 75,725,380 V1920G probably damaging Het
Atp6v0d2 C T 4: 19,880,055 V281I probably benign Het
AW209491 T G 13: 14,637,022 S153R probably damaging Het
Brd7 A T 8: 88,342,767 Y433* probably null Het
Bub1b A G 2: 118,609,976 H187R probably damaging Het
Clstn2 T A 9: 97,570,628 Q242L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Comt T C 16: 18,407,961 Y225C probably damaging Het
Ctbs T A 3: 146,455,107 L143Q probably damaging Het
Ctsw T C 19: 5,465,461 probably benign Het
Dhx16 T C 17: 35,883,302 I435T probably damaging Het
Dmxl1 T C 18: 49,893,402 F1859S probably damaging Het
Glud1 A G 14: 34,329,394 probably benign Het
Gm8220 A G 14: 44,286,791 H71R probably damaging Het
Gnb1l A G 16: 18,552,473 E238G probably benign Het
H2-T23 T C 17: 36,030,583 H332R probably benign Het
Itga5 T A 15: 103,350,769 T744S probably benign Het
Larp1 A G 11: 58,047,750 E453G probably benign Het
Lrrk2 C A 15: 91,755,962 P1570Q probably benign Het
Lrsam1 C T 2: 32,953,443 R150Q possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Msln T C 17: 25,750,796 Y320C probably damaging Het
Mtbp T C 15: 55,563,090 probably null Het
Muc5b A G 7: 141,850,446 probably null Het
Mup21 A G 4: 62,150,310 S40P probably damaging Het
Myh8 T C 11: 67,286,264 V414A probably damaging Het
P2rx5 T C 11: 73,165,574 I108T probably damaging Het
Paqr9 T C 9: 95,560,740 L261P probably damaging Het
Pde5a A G 3: 122,729,331 D29G probably benign Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pih1d1 A G 7: 45,159,682 D230G probably benign Het
Pik3r1 G T 13: 101,686,264 D643E probably benign Het
Rnf207 A G 4: 152,312,064 probably benign Het
Sept9 T C 11: 117,356,325 probably benign Het
Serinc1 A T 10: 57,525,383 S105T probably benign Het
Slc8a1 A G 17: 81,437,748 S676P probably benign Het
Srrm4 C T 5: 116,444,885 probably null Het
Tcn2 T A 11: 3,919,349 D391V probably benign Het
Tmem131 T C 1: 36,816,222 T808A probably damaging Het
Unc79 T C 12: 103,173,444 probably benign Het
Xpo6 G A 7: 126,129,543 probably benign Het
Zfp667 A T 7: 6,306,092 K586N possibly damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104141777 missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104142824 missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104142196 missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104142398 missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104142677 missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104142882 utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104142316 missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104141299 missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104142518 missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104141963 missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104142065 missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104141336 missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104142556 missense probably benign
PIT4544001:Ubqln3 UTSW 7 104141343 missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 104141840 missense probably damaging 1.00
R1019:Ubqln3 UTSW 7 104141386 missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104142076 missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 104142790 missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 104141546 missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104142860 missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104141021 missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104142151 missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 104142311 missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104141635 nonsense probably null
R2366:Ubqln3 UTSW 7 104141049 missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104141803 missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104142814 missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104141444 missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104142491 missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104141672 missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104142433 missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104140910 missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104141699 missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104142317 nonsense probably null
R6272:Ubqln3 UTSW 7 104142178 missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 104141617 missense probably benign 0.00
R6936:Ubqln3 UTSW 7 104142310 missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 104141423 missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 104141275 missense probably benign 0.01
R7079:Ubqln3 UTSW 7 104141371 missense probably benign 0.12
R7733:Ubqln3 UTSW 7 104141076 missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104141236 missense possibly damaging 0.52
R8009:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
RF054:Ubqln3 UTSW 7 104141178 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTTACCCAGAAAGCTTGGAAGCC -3'
(R):5'- TCTTGACAATCCTCACATGCAGCAC -3'

Sequencing Primer
(F):5'- GGAAGCCTATTTCTATTTTCAGATGC -3'
(R):5'- CAGAACCCTGAGATTGGTCATATTC -3'
Posted On2013-10-16