Incidental Mutation 'R0845:AW209491'
ID77336
Institutional Source Beutler Lab
Gene Symbol AW209491
Ensembl Gene ENSMUSG00000039182
Gene Nameexpressed sequence AW209491
Synonyms
MMRRC Submission 039024-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R0845 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location14630154-14639096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 14637022 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 153 (S153R)
Ref Sequence ENSEMBL: ENSMUSP00000136376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038690] [ENSMUST00000178289] [ENSMUST00000221168] [ENSMUST00000222052]
Predicted Effect probably damaging
Transcript: ENSMUST00000038690
AA Change: S153R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041523
Gene: ENSMUSG00000039182
AA Change: S153R

DomainStartEndE-ValueType
Pfam:DUF1308 38 401 2.2e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178289
AA Change: S153R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136376
Gene: ENSMUSG00000039182
AA Change: S153R

DomainStartEndE-ValueType
Pfam:DUF1308 37 401 1.1e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221168
Predicted Effect probably benign
Transcript: ENSMUST00000222052
Meta Mutation Damage Score 0.5834 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.2%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 G T 7: 28,913,430 A116E probably damaging Het
Adamtsl3 A G 7: 82,575,996 I338V probably damaging Het
Akap13 T G 7: 75,725,380 V1920G probably damaging Het
Atp6v0d2 C T 4: 19,880,055 V281I probably benign Het
Brd7 A T 8: 88,342,767 Y433* probably null Het
Bub1b A G 2: 118,609,976 H187R probably damaging Het
Clstn2 T A 9: 97,570,628 Q242L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Comt T C 16: 18,407,961 Y225C probably damaging Het
Ctbs T A 3: 146,455,107 L143Q probably damaging Het
Ctsw T C 19: 5,465,461 probably benign Het
Dhx16 T C 17: 35,883,302 I435T probably damaging Het
Dmxl1 T C 18: 49,893,402 F1859S probably damaging Het
Glud1 A G 14: 34,329,394 probably benign Het
Gm8220 A G 14: 44,286,791 H71R probably damaging Het
Gnb1l A G 16: 18,552,473 E238G probably benign Het
H2-T23 T C 17: 36,030,583 H332R probably benign Het
Itga5 T A 15: 103,350,769 T744S probably benign Het
Larp1 A G 11: 58,047,750 E453G probably benign Het
Lrrk2 C A 15: 91,755,962 P1570Q probably benign Het
Lrsam1 C T 2: 32,953,443 R150Q possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Msln T C 17: 25,750,796 Y320C probably damaging Het
Mtbp T C 15: 55,563,090 probably null Het
Muc5b A G 7: 141,850,446 probably null Het
Mup21 A G 4: 62,150,310 S40P probably damaging Het
Myh8 T C 11: 67,286,264 V414A probably damaging Het
P2rx5 T C 11: 73,165,574 I108T probably damaging Het
Paqr9 T C 9: 95,560,740 L261P probably damaging Het
Pde5a A G 3: 122,729,331 D29G probably benign Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pih1d1 A G 7: 45,159,682 D230G probably benign Het
Pik3r1 G T 13: 101,686,264 D643E probably benign Het
Rnf207 A G 4: 152,312,064 probably benign Het
Sept9 T C 11: 117,356,325 probably benign Het
Serinc1 A T 10: 57,525,383 S105T probably benign Het
Slc8a1 A G 17: 81,437,748 S676P probably benign Het
Srrm4 C T 5: 116,444,885 probably null Het
Tcn2 T A 11: 3,919,349 D391V probably benign Het
Tmem131 T C 1: 36,816,222 T808A probably damaging Het
Ubqln3 G T 7: 104,142,068 Q272K probably damaging Het
Unc79 T C 12: 103,173,444 probably benign Het
Xpo6 G A 7: 126,129,543 probably benign Het
Zfp667 A T 7: 6,306,092 K586N possibly damaging Het
Other mutations in AW209491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:AW209491 APN 13 14637075 missense probably damaging 0.98
IGL02634:AW209491 APN 13 14637683 missense probably damaging 0.99
IGL02635:AW209491 APN 13 14637267 missense possibly damaging 0.46
IGL03401:AW209491 APN 13 14637456 missense probably benign
R0067:AW209491 UTSW 13 14637743 missense probably benign 0.24
R0067:AW209491 UTSW 13 14637743 missense probably benign 0.24
R0536:AW209491 UTSW 13 14636973 missense probably damaging 1.00
R0539:AW209491 UTSW 13 14637732 missense probably damaging 1.00
R1851:AW209491 UTSW 13 14636733 missense possibly damaging 0.73
R4110:AW209491 UTSW 13 14637573 missense probably damaging 1.00
R4379:AW209491 UTSW 13 14637827 makesense probably null
R5153:AW209491 UTSW 13 14637179 missense probably benign
R5987:AW209491 UTSW 13 14637780 missense probably benign 0.00
R5988:AW209491 UTSW 13 14637780 missense probably benign 0.00
R5990:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6019:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6021:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6022:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6160:AW209491 UTSW 13 14636721 missense probably damaging 0.99
R6179:AW209491 UTSW 13 14637083 missense possibly damaging 0.92
R6194:AW209491 UTSW 13 14637120 missense possibly damaging 0.89
R7594:AW209491 UTSW 13 14637246 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCCATCGTGGAATCGGCAG -3'
(R):5'- CAGAAGTTCTTGGCCCTCGTCATC -3'

Sequencing Primer
(F):5'- TTCGGCTACACAGACACCTTG -3'
(R):5'- GGCCCTCGTCATCTGACTC -3'
Posted On2013-10-16