Incidental Mutation 'R0845:H2-T23'
ID77347
Institutional Source Beutler Lab
Gene Symbol H2-T23
Ensembl Gene ENSMUSG00000067212
Gene Namehistocompatibility 2, T region locus 23
Synonyms37b, T18c(37), 37c, Qa-1, Qed-1, T23b, T18c, T23d, H-2T23, Qa1
MMRRC Submission 039024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0845 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36029773-36032855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36030583 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 332 (H332R)
Ref Sequence ENSEMBL: ENSMUSP00000099739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102678]
PDB Structure
Structure of the MHC class Ib molecule Qa-1b [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000102678
AA Change: H332R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099739
Gene: ENSMUSG00000067212
AA Change: H332R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 21 199 1.9e-93 PFAM
IGc1 218 289 1.89e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174839
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.2%
Validation Efficiency 96% (45/47)
MGI Phenotype PHENOTYPE: CD4+ T cells from mice with a homozygous null mutation have enhanced responses after infection or immunization, are resistant to suppressor activity mediated by a subset of CD8+ T cells, but are more susceptible to NK cell lysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 G T 7: 28,913,430 A116E probably damaging Het
Adamtsl3 A G 7: 82,575,996 I338V probably damaging Het
Akap13 T G 7: 75,725,380 V1920G probably damaging Het
Atp6v0d2 C T 4: 19,880,055 V281I probably benign Het
AW209491 T G 13: 14,637,022 S153R probably damaging Het
Brd7 A T 8: 88,342,767 Y433* probably null Het
Bub1b A G 2: 118,609,976 H187R probably damaging Het
Clstn2 T A 9: 97,570,628 Q242L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Comt T C 16: 18,407,961 Y225C probably damaging Het
Ctbs T A 3: 146,455,107 L143Q probably damaging Het
Ctsw T C 19: 5,465,461 probably benign Het
Dhx16 T C 17: 35,883,302 I435T probably damaging Het
Dmxl1 T C 18: 49,893,402 F1859S probably damaging Het
Glud1 A G 14: 34,329,394 probably benign Het
Gm8220 A G 14: 44,286,791 H71R probably damaging Het
Gnb1l A G 16: 18,552,473 E238G probably benign Het
Itga5 T A 15: 103,350,769 T744S probably benign Het
Larp1 A G 11: 58,047,750 E453G probably benign Het
Lrrk2 C A 15: 91,755,962 P1570Q probably benign Het
Lrsam1 C T 2: 32,953,443 R150Q possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Msln T C 17: 25,750,796 Y320C probably damaging Het
Mtbp T C 15: 55,563,090 probably null Het
Muc5b A G 7: 141,850,446 probably null Het
Mup21 A G 4: 62,150,310 S40P probably damaging Het
Myh8 T C 11: 67,286,264 V414A probably damaging Het
P2rx5 T C 11: 73,165,574 I108T probably damaging Het
Paqr9 T C 9: 95,560,740 L261P probably damaging Het
Pde5a A G 3: 122,729,331 D29G probably benign Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pih1d1 A G 7: 45,159,682 D230G probably benign Het
Pik3r1 G T 13: 101,686,264 D643E probably benign Het
Rnf207 A G 4: 152,312,064 probably benign Het
Sept9 T C 11: 117,356,325 probably benign Het
Serinc1 A T 10: 57,525,383 S105T probably benign Het
Slc8a1 A G 17: 81,437,748 S676P probably benign Het
Srrm4 C T 5: 116,444,885 probably null Het
Tcn2 T A 11: 3,919,349 D391V probably benign Het
Tmem131 T C 1: 36,816,222 T808A probably damaging Het
Ubqln3 G T 7: 104,142,068 Q272K probably damaging Het
Unc79 T C 12: 103,173,444 probably benign Het
Xpo6 G A 7: 126,129,543 probably benign Het
Zfp667 A T 7: 6,306,092 K586N possibly damaging Het
Other mutations in H2-T23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:H2-T23 APN 17 36031781 missense probably damaging 1.00
IGL01685:H2-T23 APN 17 36032644 missense probably benign 0.29
IGL02756:H2-T23 APN 17 36031688 missense probably damaging 1.00
IGL03036:H2-T23 APN 17 36032357 missense possibly damaging 0.73
LCD18:H2-T23 UTSW 17 36031216 intron probably benign
R0539:H2-T23 UTSW 17 36032141 splice site probably benign
R1727:H2-T23 UTSW 17 36031653 missense possibly damaging 0.52
R2044:H2-T23 UTSW 17 36032191 missense probably damaging 1.00
R3121:H2-T23 UTSW 17 36030963 missense probably benign 0.13
R3122:H2-T23 UTSW 17 36030963 missense probably benign 0.13
R3943:H2-T23 UTSW 17 36030643 missense probably benign 0.01
R3944:H2-T23 UTSW 17 36030643 missense probably benign 0.01
R4492:H2-T23 UTSW 17 36032166 missense probably damaging 0.97
R4660:H2-T23 UTSW 17 36030216 missense probably damaging 0.99
R4669:H2-T23 UTSW 17 36031798 missense probably damaging 1.00
R4740:H2-T23 UTSW 17 36032124 intron probably benign
R5151:H2-T23 UTSW 17 36032338 missense probably damaging 1.00
R5196:H2-T23 UTSW 17 36032607 critical splice donor site probably null
R5237:H2-T23 UTSW 17 36030366 splice site probably null
R5307:H2-T23 UTSW 17 36032216 missense probably benign 0.00
R5336:H2-T23 UTSW 17 36031658 missense possibly damaging 0.85
R5646:H2-T23 UTSW 17 36031803 missense possibly damaging 0.49
R5800:H2-T23 UTSW 17 36031604 intron probably benign
R6013:H2-T23 UTSW 17 36030582 missense probably benign 0.00
R6081:H2-T23 UTSW 17 36031815 missense possibly damaging 0.90
R6382:H2-T23 UTSW 17 36031832 missense probably damaging 1.00
R7043:H2-T23 UTSW 17 36031911 missense probably damaging 1.00
R7134:H2-T23 UTSW 17 36031817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGGATTTTCATGCCTTCTGAG -3'
(R):5'- GGGAAGGAGCAGTATTACACATGCC -3'

Sequencing Primer
(F):5'- CAGAGGTCTGGAAGCTCTTGC -3'
(R):5'- ACATGCCATGTGTACCATGAG -3'
Posted On2013-10-16