Incidental Mutation 'R0846:Fitm2'
ID77359
Institutional Source Beutler Lab
Gene Symbol Fitm2
Ensembl Gene ENSMUSG00000048486
Gene Namefat storage-inducing transmembrane protein 2
SynonymsD930001I22Rik, Fit2
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0846 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location163466379-163472629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163469814 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 160 (T160A)
Ref Sequence ENSEMBL: ENSMUSP00000105045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109418]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065731
SMART Domains Protein: ENSMUSP00000069586
Gene: ENSMUSG00000053353

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109418
AA Change: T160A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105045
Gene: ENSMUSG00000048486
AA Change: T160A

DomainStartEndE-ValueType
Pfam:Scs3p 45 190 2.2e-23 PFAM
transmembrane domain 220 239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186760
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FIT2 belongs to an evolutionarily conserved family of proteins involved in fat storage (Kadereit et al., 2008 [PubMed 18160536]).[supplied by OMIM, May 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Fitm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Fitm2 APN 2 163469792 missense probably benign 0.03
IGL03227:Fitm2 APN 2 163469532 missense probably benign 0.00
R0481:Fitm2 UTSW 2 163469714 missense probably benign 0.21
R1595:Fitm2 UTSW 2 163469690 missense probably benign 0.12
R2205:Fitm2 UTSW 2 163472596 start gained probably benign
R2208:Fitm2 UTSW 2 163472684 unclassified probably benign
R3113:Fitm2 UTSW 2 163469591 missense probably damaging 1.00
R4559:Fitm2 UTSW 2 163472673 unclassified probably benign
R6052:Fitm2 UTSW 2 163470116 missense probably damaging 1.00
R6150:Fitm2 UTSW 2 163470074 missense probably damaging 1.00
R7469:Fitm2 UTSW 2 163469822 missense probably damaging 1.00
R7694:Fitm2 UTSW 2 163469972 missense probably damaging 0.98
R7774:Fitm2 UTSW 2 163470066 missense probably damaging 0.99
R7833:Fitm2 UTSW 2 163470099 missense probably damaging 1.00
R7916:Fitm2 UTSW 2 163470099 missense probably damaging 1.00
Z1088:Fitm2 UTSW 2 163469865 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCGAACACTTTCTGGGTCAAGTC -3'
(R):5'- TGCCAAGTCTGGTCTTCACCTGTG -3'

Sequencing Primer
(F):5'- CTGGGTCAAGTCGTGGAAATAAAC -3'
(R):5'- TACCACCTGACGGGCAAG -3'
Posted On2013-10-16