Incidental Mutation 'R0846:Gm12794'
ID77363
Institutional Source Beutler Lab
Gene Symbol Gm12794
Ensembl Gene ENSMUSG00000070890
Gene Namepredicted gene 12794
Synonyms
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0846 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location101940407-101943183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101941250 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 139 (K139N)
Ref Sequence ENSEMBL: ENSMUSP00000051550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052027]
Predicted Effect probably benign
Transcript: ENSMUST00000052027
AA Change: K139N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051550
Gene: ENSMUSG00000070890
AA Change: K139N

DomainStartEndE-ValueType
SCOP:d1a4ya_ 257 409 9e-11 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Gm12794
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Gm12794 APN 4 101941701 missense probably benign 0.02
IGL01360:Gm12794 APN 4 101940468 missense possibly damaging 0.94
IGL01837:Gm12794 APN 4 101941453 missense probably damaging 1.00
IGL01870:Gm12794 APN 4 101940690 missense probably benign 0.03
IGL02040:Gm12794 APN 4 101941134 missense possibly damaging 0.94
IGL03264:Gm12794 APN 4 101941132 missense probably damaging 0.99
R0033:Gm12794 UTSW 4 101941684 missense probably benign
R0334:Gm12794 UTSW 4 101941584 missense probably benign 0.01
R1464:Gm12794 UTSW 4 101941306 missense probably damaging 0.97
R1464:Gm12794 UTSW 4 101941306 missense probably damaging 0.97
R1774:Gm12794 UTSW 4 101940458 missense probably benign 0.27
R1888:Gm12794 UTSW 4 101941138 missense probably damaging 0.99
R1888:Gm12794 UTSW 4 101941138 missense probably damaging 0.99
R4510:Gm12794 UTSW 4 101941560 missense probably benign 0.00
R4511:Gm12794 UTSW 4 101941560 missense probably benign 0.00
R4890:Gm12794 UTSW 4 101941591 missense probably damaging 0.99
R4960:Gm12794 UTSW 4 101941464 missense probably benign
R5043:Gm12794 UTSW 4 101940524 missense possibly damaging 0.89
R5297:Gm12794 UTSW 4 101941151 missense possibly damaging 0.46
R5780:Gm12794 UTSW 4 101941527 missense probably damaging 1.00
R5957:Gm12794 UTSW 4 101941701 missense probably benign 0.02
R6409:Gm12794 UTSW 4 101940677 nonsense probably null
R6452:Gm12794 UTSW 4 101941443 missense probably benign 0.02
R7619:Gm12794 UTSW 4 101941300 missense probably benign 0.01
Z1177:Gm12794 UTSW 4 101941125 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCTCATGCAGTGTTCTTGCC -3'
(R):5'- AGCAGAAACAGGTCCCCATCTTTCC -3'

Sequencing Primer
(F):5'- TGCTATGATGGAGCTGACATTAGAC -3'
(R):5'- AGGAATTTGGCAGCACCTC -3'
Posted On2013-10-16