Incidental Mutation 'R0846:Sync'
ID77365
Institutional Source Beutler Lab
Gene Symbol Sync
Ensembl Gene ENSMUSG00000001333
Gene Namesyncoilin
Synonyms1110057H03Rik, SNIP4
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R0846 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129287617-129308559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129294104 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 310 (S310G)
Ref Sequence ENSEMBL: ENSMUSP00000099659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102599]
Predicted Effect probably benign
Transcript: ENSMUST00000102599
AA Change: S310G

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099659
Gene: ENSMUSG00000001333
AA Change: S310G

DomainStartEndE-ValueType
low complexity region 65 75 N/A INTRINSIC
Filament 156 453 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146448
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes for one knock-out allele show reduced generation of isometric stress in skeletal muscle but a normal response to eccentric contraction-induced injury. Homozygotes for another knock-out allele show impaired contractility and increased skeletalmuscle damage under a forced exercise regime. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Sync
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Sync APN 4 129293951 missense probably damaging 0.99
PIT4354001:Sync UTSW 4 129306654 missense possibly damaging 0.71
R0017:Sync UTSW 4 129293744 missense probably damaging 1.00
R0017:Sync UTSW 4 129293744 missense probably damaging 1.00
R0242:Sync UTSW 4 129293721 missense probably damaging 1.00
R0242:Sync UTSW 4 129293721 missense probably damaging 1.00
R0825:Sync UTSW 4 129293397 missense probably benign 0.04
R3824:Sync UTSW 4 129294363 missense possibly damaging 0.95
R4151:Sync UTSW 4 129293726 nonsense probably null
R4166:Sync UTSW 4 129306742 intron probably benign
R4760:Sync UTSW 4 129293439 missense probably benign 0.01
R5753:Sync UTSW 4 129293386 nonsense probably null
R6120:Sync UTSW 4 129293751 missense probably damaging 1.00
R6578:Sync UTSW 4 129294267 missense probably damaging 1.00
R6860:Sync UTSW 4 129287790 critical splice donor site probably null
R7347:Sync UTSW 4 129294306 missense probably benign 0.22
R7612:Sync UTSW 4 129293582 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCTGTTCAAGGTGACCAAGGAATGC -3'
(R):5'- TCCTGTTCTGAAGTTGGAGCTGCC -3'

Sequencing Primer
(F):5'- TGCGTGGCTTACCAATACCAG -3'
(R):5'- TCTGCTTCCAGGGGTCG -3'
Posted On2013-10-16