Incidental Mutation 'R0846:Aak1'
ID77369
Institutional Source Beutler Lab
Gene Symbol Aak1
Ensembl Gene ENSMUSG00000057230
Gene NameAP2 associated kinase 1
Synonyms5530400K14Rik, D6Ertd245e
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R0846 (G1)
Quality Score222
Status Not validated
Chromosome6
Chromosomal Location86849517-87003223 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 86959089 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003710] [ENSMUST00000089519]
Predicted Effect probably benign
Transcript: ENSMUST00000003710
SMART Domains Protein: ENSMUSP00000003710
Gene: ENSMUSG00000057230

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 1.5e-27 PFAM
Pfam:Pkinase 46 312 7e-43 PFAM
low complexity region 420 489 N/A INTRINSIC
low complexity region 494 527 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 712 730 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000089519
AA Change: S528P
SMART Domains Protein: ENSMUSP00000086948
Gene: ENSMUSG00000057230
AA Change: S528P

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 1e-26 PFAM
Pfam:Pkinase 46 312 2.2e-44 PFAM
low complexity region 420 489 N/A INTRINSIC
low complexity region 494 510 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 608 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 716 728 N/A INTRINSIC
low complexity region 793 811 N/A INTRINSIC
low complexity region 929 942 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204613
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor-related protein complex 2 (AP-2 complexes) functions during receptor-mediated endocytosis to trigger clathrin assembly, interact with membrane-bound receptors, and recruit encodytic accessory factors. This gene encodes a member of the SNF1 subfamily of Ser/Thr protein kinases. The protein interacts with and phosphorylates a subunit of the AP-2 complex, which promotes binding of AP-2 to sorting signals found in membrane-bound receptors and subsequent receptor endocytosis. Its kinase activity is stimulated by clathrin. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Aak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Aak1 APN 6 86946153 missense probably damaging 1.00
IGL01284:Aak1 APN 6 86850053 start codon destroyed possibly damaging 0.86
IGL01292:Aak1 APN 6 86949538 splice site probably benign
IGL01344:Aak1 APN 6 86946157 missense possibly damaging 0.49
IGL02317:Aak1 APN 6 86956300 missense possibly damaging 0.61
IGL02422:Aak1 APN 6 86982616 missense unknown
IGL02531:Aak1 APN 6 86956447 missense unknown
IGL02719:Aak1 APN 6 86959170 intron probably benign
IGL03051:Aak1 APN 6 86987301 utr 3 prime probably benign
R0382:Aak1 UTSW 6 86946919 missense probably benign 0.19
R1074:Aak1 UTSW 6 86935439 missense probably damaging 0.97
R1141:Aak1 UTSW 6 86965476 critical splice acceptor site probably null
R1221:Aak1 UTSW 6 86965478 missense unknown
R1261:Aak1 UTSW 6 86935488 missense probably benign 0.09
R1262:Aak1 UTSW 6 86935488 missense probably benign 0.09
R1470:Aak1 UTSW 6 86967355 missense unknown
R1470:Aak1 UTSW 6 86967355 missense unknown
R1931:Aak1 UTSW 6 86956336 missense unknown
R3713:Aak1 UTSW 6 86955190 missense probably benign 0.19
R3785:Aak1 UTSW 6 86965578 missense unknown
R3815:Aak1 UTSW 6 86959042 intron probably benign
R3816:Aak1 UTSW 6 86959042 intron probably benign
R3819:Aak1 UTSW 6 86959042 intron probably benign
R4165:Aak1 UTSW 6 86850062 missense probably damaging 1.00
R4166:Aak1 UTSW 6 86850062 missense probably damaging 1.00
R4351:Aak1 UTSW 6 86935537 splice site probably null
R4430:Aak1 UTSW 6 86986366 missense unknown
R4431:Aak1 UTSW 6 86986318 missense unknown
R4665:Aak1 UTSW 6 86925077 missense probably null 1.00
R4821:Aak1 UTSW 6 86850189 missense probably damaging 1.00
R5088:Aak1 UTSW 6 86944480 critical splice donor site probably null
R5543:Aak1 UTSW 6 86982645 critical splice donor site probably null
R5567:Aak1 UTSW 6 86955168 nonsense probably null
R5726:Aak1 UTSW 6 86925124 nonsense probably null
R6083:Aak1 UTSW 6 86963996 missense unknown
R6269:Aak1 UTSW 6 86964051 missense unknown
R6693:Aak1 UTSW 6 86965515 missense unknown
R6700:Aak1 UTSW 6 86964203 missense unknown
R6759:Aak1 UTSW 6 86944417 missense probably damaging 1.00
R6969:Aak1 UTSW 6 86981335 missense unknown
Y4335:Aak1 UTSW 6 86959142 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCAAATGTTGCCCAATTCTCATGCC -3'
(R):5'- GAGCAACTTGACCCTAACTCAGAGC -3'

Sequencing Primer
(F):5'- CAACAACTGTGCTTTTGCTGG -3'
(R):5'- CTAACTCAGAGCCCCTGTG -3'
Posted On2013-10-16