Incidental Mutation 'R0846:Zfp773'
ID77372
Institutional Source Beutler Lab
Gene Symbol Zfp773
Ensembl Gene ENSMUSG00000063535
Gene Namezinc finger protein 773
Synonyms2810409K11Rik
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0846 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location7127073-7136755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7132692 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 302 (C302S)
Ref Sequence ENSEMBL: ENSMUSP00000032622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032622] [ENSMUST00000211240]
Predicted Effect probably damaging
Transcript: ENSMUST00000032622
AA Change: C302S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032622
Gene: ENSMUSG00000063535
AA Change: C302S

DomainStartEndE-ValueType
KRAB 75 134 6.82e-8 SMART
ZnF_C2H2 241 263 1.31e0 SMART
ZnF_C2H2 269 291 1.5e-4 SMART
ZnF_C2H2 297 319 4.17e-3 SMART
ZnF_C2H2 325 347 2.05e-2 SMART
ZnF_C2H2 353 375 2.24e-3 SMART
ZnF_C2H2 381 403 8.81e-2 SMART
ZnF_C2H2 409 431 7.26e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211240
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Other mutations in Zfp773
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Zfp773 APN 7 7132684 missense probably damaging 1.00
IGL00780:Zfp773 APN 7 7133114 missense probably benign 0.00
IGL01348:Zfp773 APN 7 7135315 missense possibly damaging 0.93
IGL02224:Zfp773 APN 7 7132976 missense probably benign 0.00
IGL02447:Zfp773 APN 7 7136656 utr 5 prime probably benign
IGL02869:Zfp773 APN 7 7134233 missense probably benign 0.22
R0505:Zfp773 UTSW 7 7133024 missense probably benign 0.03
R0585:Zfp773 UTSW 7 7132575 missense probably benign 0.21
R0804:Zfp773 UTSW 7 7133093 intron probably benign
R1179:Zfp773 UTSW 7 7133093 intron probably benign
R2847:Zfp773 UTSW 7 7133093 intron probably benign
R3841:Zfp773 UTSW 7 7132391 missense possibly damaging 0.92
R4116:Zfp773 UTSW 7 7133093 intron probably benign
R4638:Zfp773 UTSW 7 7135336 missense probably damaging 1.00
R5126:Zfp773 UTSW 7 7136624 missense unknown
R6142:Zfp773 UTSW 7 7132482 missense probably benign 0.00
R7072:Zfp773 UTSW 7 7132875 missense probably benign 0.15
R7232:Zfp773 UTSW 7 7132985 missense probably benign 0.14
R7748:Zfp773 UTSW 7 7132908 missense probably benign 0.04
R7888:Zfp773 UTSW 7 7132979 missense probably benign 0.00
R7971:Zfp773 UTSW 7 7132979 missense probably benign 0.00
RF007:Zfp773 UTSW 7 7132690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTACACTGGCTGCACTCAAAAG -3'
(R):5'- AGCTGAGCCATGCTGAGAAACC -3'

Sequencing Primer
(F):5'- cttaaataattttccacactcgcc -3'
(R):5'- GCAGAATGCAGAATTTCAGTTCC -3'
Posted On2013-10-16