Incidental Mutation 'R0846:Slc17a8'
ID77376
Institutional Source Beutler Lab
Gene Symbol Slc17a8
Ensembl Gene ENSMUSG00000019935
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8
SynonymsVglut3
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0846 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location89574020-89621253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89606734 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 79 (D79G)
Ref Sequence ENSEMBL: ENSMUSP00000020102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020102]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020102
AA Change: D79G

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020102
Gene: ENSMUSG00000019935
AA Change: D79G

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
internal_repeat_1 62 77 3.74e-7 PROSPERO
internal_repeat_1 75 90 3.74e-7 PROSPERO
Pfam:MFS_1 95 478 1e-46 PFAM
transmembrane domain 493 515 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a vesicular glutamate transporter. The encoded protein transports the neurotransmitter glutamate into synaptic vesicles before it is released into the synaptic cleft. Mutations in this gene are the cause of autosomal-dominant nonsyndromic type 25 deafness. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sensorineural hearing loss, cochlear ganglion degeneration, decreased synaptic glutamate release, and nonconvulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Slc17a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Slc17a8 APN 10 89591295 missense possibly damaging 0.70
IGL00990:Slc17a8 APN 10 89576530 missense probably benign 0.01
IGL01317:Slc17a8 APN 10 89620804 missense probably benign 0.02
IGL01339:Slc17a8 APN 10 89591244 missense probably damaging 1.00
IGL01468:Slc17a8 APN 10 89592021 critical splice donor site probably null
IGL02401:Slc17a8 APN 10 89576660 splice site probably null
IGL02638:Slc17a8 APN 10 89576603 nonsense probably null
IGL02859:Slc17a8 APN 10 89576584 missense probably benign 0.11
R0518:Slc17a8 UTSW 10 89576330 missense probably benign 0.00
R0521:Slc17a8 UTSW 10 89576330 missense probably benign 0.00
R0610:Slc17a8 UTSW 10 89576626 missense probably damaging 0.99
R0928:Slc17a8 UTSW 10 89598683 missense probably damaging 1.00
R1277:Slc17a8 UTSW 10 89597457 missense possibly damaging 0.80
R1401:Slc17a8 UTSW 10 89591214 missense probably damaging 1.00
R1854:Slc17a8 UTSW 10 89606765 missense unknown
R1935:Slc17a8 UTSW 10 89577915 missense probably benign 0.03
R1936:Slc17a8 UTSW 10 89577915 missense probably benign 0.03
R3887:Slc17a8 UTSW 10 89591138 splice site probably benign
R4227:Slc17a8 UTSW 10 89598713 missense probably damaging 1.00
R4872:Slc17a8 UTSW 10 89576505 missense probably benign 0.38
R5023:Slc17a8 UTSW 10 89576560 missense probably benign 0.01
R5330:Slc17a8 UTSW 10 89589494 critical splice donor site probably null
R5331:Slc17a8 UTSW 10 89589494 critical splice donor site probably null
R5576:Slc17a8 UTSW 10 89597502 missense probably damaging 1.00
R5593:Slc17a8 UTSW 10 89606840 missense probably benign
R6035:Slc17a8 UTSW 10 89592075 missense possibly damaging 0.67
R6035:Slc17a8 UTSW 10 89592075 missense possibly damaging 0.67
R7038:Slc17a8 UTSW 10 89600221 missense probably benign 0.00
R7220:Slc17a8 UTSW 10 89576413 missense probably benign
R7514:Slc17a8 UTSW 10 89592107 missense probably damaging 1.00
R7574:Slc17a8 UTSW 10 89592146 missense probably benign 0.01
R7689:Slc17a8 UTSW 10 89597457 missense possibly damaging 0.80
X0021:Slc17a8 UTSW 10 89598682 missense probably damaging 1.00
X0067:Slc17a8 UTSW 10 89592912 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTATGTCTCCTGGAGTCCAAGGTC -3'
(R):5'- TTTTACAGCGCAAGCTGAGCCC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- TGCCTCACCTTGAATACTGG -3'
Posted On2013-10-16