Incidental Mutation 'R0846:Caps2'
ID77378
Institutional Source Beutler Lab
Gene Symbol Caps2
Ensembl Gene ENSMUSG00000035694
Gene Namecalcyphosphine 2
Synonyms
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0846 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location112163621-112216555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112215585 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 587 (R587H)
Ref Sequence ENSEMBL: ENSMUSP00000129887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092176] [ENSMUST00000170013]
Predicted Effect probably damaging
Transcript: ENSMUST00000092176
AA Change: R545H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089815
Gene: ENSMUSG00000035694
AA Change: R545H

DomainStartEndE-ValueType
Pfam:EF-hand_6 384 420 2e-4 PFAM
Blast:EFh 457 485 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132994
Predicted Effect probably damaging
Transcript: ENSMUST00000170013
AA Change: R587H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129887
Gene: ENSMUSG00000035694
AA Change: R587H

DomainStartEndE-ValueType
PDB:3E3R|B 403 592 4e-27 PDB
Blast:EFh 425 453 1e-7 BLAST
SCOP:d1hqva_ 430 522 4e-10 SMART
Blast:EFh 461 491 3e-6 BLAST
Blast:EFh 499 527 6e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219794
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcyphosine-2 is a calcium-binding protein with 2 EF-hand motifs (Wang et al., 2002 [PubMed 11846421]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Caps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Caps2 APN 10 112183060 missense probably damaging 1.00
IGL02159:Caps2 APN 10 112204023 missense probably benign 0.25
IGL02412:Caps2 APN 10 112204036 critical splice donor site probably null
IGL03380:Caps2 APN 10 112200696 missense probably benign 0.05
R0601:Caps2 UTSW 10 112195790 missense possibly damaging 0.95
R0658:Caps2 UTSW 10 112204038 splice site probably benign
R1472:Caps2 UTSW 10 112179472 missense probably benign 0.26
R1711:Caps2 UTSW 10 112190978 missense possibly damaging 0.86
R1834:Caps2 UTSW 10 112195718 missense possibly damaging 0.89
R1990:Caps2 UTSW 10 112200686 missense probably benign 0.01
R1996:Caps2 UTSW 10 112204003 missense probably damaging 1.00
R2077:Caps2 UTSW 10 112199727 missense possibly damaging 0.71
R3161:Caps2 UTSW 10 112182486 nonsense probably null
R3162:Caps2 UTSW 10 112182486 nonsense probably null
R3162:Caps2 UTSW 10 112182486 nonsense probably null
R3716:Caps2 UTSW 10 112200732 missense probably benign 0.00
R4702:Caps2 UTSW 10 112208347 missense probably damaging 1.00
R4978:Caps2 UTSW 10 112182494 missense probably benign 0.04
R5285:Caps2 UTSW 10 112208311 missense probably benign
R5911:Caps2 UTSW 10 112165686 start gained probably benign
R5933:Caps2 UTSW 10 112215446 missense probably benign 0.38
R6368:Caps2 UTSW 10 112194968 nonsense probably null
R6476:Caps2 UTSW 10 112175560 missense possibly damaging 0.66
R7442:Caps2 UTSW 10 112208354 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATAAGCATCCCTCTATCACCACCTG -3'
(R):5'- AGTTGCACTACTTCAGCCTTGATCTG -3'

Sequencing Primer
(F):5'- ACCACCTGTCATTTTGCTGAAC -3'
(R):5'- GTTCTCAAAAGCACACATCTATTTCC -3'
Posted On2013-10-16