Incidental Mutation 'R0846:Pdxdc1'
ID77386
Institutional Source Beutler Lab
Gene Symbol Pdxdc1
Ensembl Gene ENSMUSG00000022680
Gene Namepyridoxal-dependent decarboxylase domain containing 1
Synonyms2210010A19Rik
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R0846 (G1)
Quality Score128
Status Not validated
Chromosome16
Chromosomal Location13833148-13903131 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 13854393 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023361] [ENSMUST00000115802] [ENSMUST00000115802] [ENSMUST00000115803] [ENSMUST00000115803] [ENSMUST00000115804]
Predicted Effect probably null
Transcript: ENSMUST00000023361
SMART Domains Protein: ENSMUSP00000023361
Gene: ENSMUSG00000022680

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 166 310 2.6e-12 PFAM
coiled coil region 610 631 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115802
SMART Domains Protein: ENSMUSP00000111468
Gene: ENSMUSG00000022680

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 153 316 1.8e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115802
SMART Domains Protein: ENSMUSP00000111468
Gene: ENSMUSG00000022680

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 153 316 1.8e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115803
SMART Domains Protein: ENSMUSP00000111469
Gene: ENSMUSG00000022680

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 190 293 1.4e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115803
SMART Domains Protein: ENSMUSP00000111469
Gene: ENSMUSG00000022680

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 190 293 1.4e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115804
SMART Domains Protein: ENSMUSP00000111471
Gene: ENSMUSG00000022680

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 154 308 5.5e-15 PFAM
coiled coil region 610 631 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154150
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype Homozygous mutant mice exhibit behavioral and learning defects including abnormal spontaneous activity, impaired spatial memory, and reduced exploratory activity in the presence of conspecifics.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Pdxdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Pdxdc1 APN 16 13859152 missense probably damaging 1.00
IGL02101:Pdxdc1 APN 16 13869856 missense probably damaging 0.99
IGL02484:Pdxdc1 APN 16 13876081 missense possibly damaging 0.94
IGL02523:Pdxdc1 APN 16 13881935 missense probably damaging 1.00
IGL02560:Pdxdc1 APN 16 13839732 missense probably benign 0.00
IGL02884:Pdxdc1 APN 16 13843795 missense possibly damaging 0.86
IGL03008:Pdxdc1 APN 16 13876159 missense possibly damaging 0.81
IGL03162:Pdxdc1 APN 16 13857417 missense probably damaging 0.99
IGL02991:Pdxdc1 UTSW 16 13857396 missense probably damaging 1.00
PIT4472001:Pdxdc1 UTSW 16 13845345 missense probably damaging 1.00
R0015:Pdxdc1 UTSW 16 13887683 splice site probably benign
R0240:Pdxdc1 UTSW 16 13879445 missense probably damaging 1.00
R0240:Pdxdc1 UTSW 16 13879445 missense probably damaging 1.00
R0432:Pdxdc1 UTSW 16 13854400 missense probably damaging 0.97
R0944:Pdxdc1 UTSW 16 13838369 missense probably damaging 1.00
R0945:Pdxdc1 UTSW 16 13857432 missense probably damaging 1.00
R1118:Pdxdc1 UTSW 16 13879414 splice site probably benign
R1726:Pdxdc1 UTSW 16 13838300 critical splice donor site probably null
R2425:Pdxdc1 UTSW 16 13879508 missense possibly damaging 0.90
R3890:Pdxdc1 UTSW 16 13836448 missense probably benign
R4452:Pdxdc1 UTSW 16 13837126 missense possibly damaging 0.55
R4516:Pdxdc1 UTSW 16 13838346 nonsense probably null
R4938:Pdxdc1 UTSW 16 13876069 missense probably benign 0.03
R5352:Pdxdc1 UTSW 16 13840311 missense probably benign 0.01
R5554:Pdxdc1 UTSW 16 13872499 missense probably benign 0.01
R7300:Pdxdc1 UTSW 16 13879510 missense probably damaging 0.99
R7356:Pdxdc1 UTSW 16 13860003 missense probably damaging 1.00
Z1176:Pdxdc1 UTSW 16 13903043 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGACTATACTGCCTCAATTCCCAACA -3'
(R):5'- AGTTGCAGATGCTTTGCCTGAGAT -3'

Sequencing Primer
(F):5'- ATTGAGagccgggtgtgg -3'
(R):5'- GCCTGAGATACTTATTTGCATATCAC -3'
Posted On2013-10-16