Incidental Mutation 'R0846:Chuk'
ID77392
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0846 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44091028 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 345 (T345A)
Ref Sequence ENSEMBL: ENSMUSP00000113809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]
Predicted Effect probably damaging
Transcript: ENSMUST00000026217
AA Change: T345A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: T345A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119591
AA Change: T345A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: T345A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147423
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R2441:Chuk UTSW 19 44096921 missense probably damaging 1.00
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4180:Chuk UTSW 19 44101840 missense probably benign 0.01
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4815:Chuk UTSW 19 44077247 nonsense probably null
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5331:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
R6865:Chuk UTSW 19 44086915 nonsense probably null
R7916:Chuk UTSW 19 44096981 missense probably damaging 1.00
R8038:Chuk UTSW 19 44078977 missense probably damaging 1.00
R8064:Chuk UTSW 19 44082676 missense probably damaging 1.00
R8187:Chuk UTSW 19 44091112 missense probably benign 0.05
R8272:Chuk UTSW 19 44103736 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- atatagcaagaccccgATCCCCAG -3'
(R):5'- CCACTCATCTGTGGTTGAGAAGCCT -3'

Sequencing Primer
(F):5'- gATCCCCAGCTCCCCCC -3'
(R):5'- GTGCACATCCTAAATATGACTTCTG -3'
Posted On2013-10-16