Incidental Mutation 'R0848:Kif1a'
ID77395
Institutional Source Beutler Lab
Gene Symbol Kif1a
Ensembl Gene ENSMUSG00000014602
Gene Namekinesin family member 1A
SynonymsLOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1
MMRRC Submission 039027-MU
Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R0848 (G1)
Quality Score159
Status Not validated
Chromosome1
Chromosomal Location93015464-93101951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93019898 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1708 (Y1708F)
Ref Sequence ENSEMBL: ENSMUSP00000140163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086819
AA Change: Y1615F

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: Y1615F

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 411 429 N/A INTRINSIC
FHA 524 581 1.39e-8 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 6.4e-13 PFAM
Pfam:DUF3694 1157 1305 1.8e-47 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112958
AA Change: Y1615F

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: Y1615F

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 851 3.9e-15 PFAM
Pfam:DUF3694 1148 1304 5e-40 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171556
AA Change: Y1606F

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: Y1606F

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 2.7e-13 PFAM
Pfam:DUF3694 1148 1296 8.4e-48 PFAM
low complexity region 1411 1435 N/A INTRINSIC
low complexity region 1532 1540 N/A INTRINSIC
PH 1575 1674 1.52e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171796
AA Change: Y1614F

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: Y1614F

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 6.4e-13 PFAM
Pfam:DUF3694 1148 1304 1.8e-46 PFAM
low complexity region 1419 1443 N/A INTRINSIC
low complexity region 1540 1548 N/A INTRINSIC
PH 1583 1682 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188136
Predicted Effect probably damaging
Transcript: ENSMUST00000190723
AA Change: Y1708F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: Y1708F

DomainStartEndE-ValueType
KISc 3 362 5.2e-180 SMART
low complexity region 411 429 N/A INTRINSIC
coiled coil region 438 471 N/A INTRINSIC
FHA 524 581 6.9e-11 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 4e-10 PFAM
low complexity region 885 900 N/A INTRINSIC
coiled coil region 901 929 N/A INTRINSIC
internal_repeat_1 938 957 5.9e-5 PROSPERO
Pfam:DUF3694 1250 1398 1.1e-44 PFAM
low complexity region 1513 1537 N/A INTRINSIC
low complexity region 1634 1642 N/A INTRINSIC
PH 1677 1776 6.9e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190854
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Kif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kif1a APN 1 93054934 missense probably damaging 1.00
IGL01574:Kif1a APN 1 93082340 missense probably damaging 1.00
IGL01637:Kif1a APN 1 93039853 missense possibly damaging 0.95
IGL01895:Kif1a APN 1 93025733 missense possibly damaging 0.65
IGL02215:Kif1a APN 1 93020549 missense probably benign 0.05
IGL02571:Kif1a APN 1 93020456 critical splice donor site probably null
IGL02734:Kif1a APN 1 93062558 missense probably damaging 1.00
IGL02752:Kif1a APN 1 93039847 missense possibly damaging 0.92
IGL02990:Kif1a APN 1 93039263 missense probably damaging 1.00
IGL03298:Kif1a APN 1 93066181 missense probably damaging 1.00
IGL03309:Kif1a APN 1 93058857 nonsense probably null
IGL03354:Kif1a APN 1 93060235 missense probably damaging 1.00
asbestos UTSW 1 93022505 missense probably damaging 1.00
chrysolite UTSW 1 93074948 splice site probably benign
osmium UTSW 1 93058810 splice site probably benign
R4538_Kif1a_397 UTSW 1 93077047 missense probably damaging 1.00
1mM(1):Kif1a UTSW 1 93077068 missense probably benign 0.00
IGL03046:Kif1a UTSW 1 93082406 missense probably damaging 1.00
PIT4508001:Kif1a UTSW 1 93046729 missense probably damaging 1.00
R0025:Kif1a UTSW 1 93042358 missense probably damaging 1.00
R0115:Kif1a UTSW 1 93046778 splice site probably benign
R0243:Kif1a UTSW 1 93042093 missense probably damaging 1.00
R0270:Kif1a UTSW 1 93054442 splice site probably benign
R0335:Kif1a UTSW 1 93052566 splice site probably benign
R0380:Kif1a UTSW 1 93056031 critical splice acceptor site probably null
R0472:Kif1a UTSW 1 93018997 missense probably damaging 0.99
R0501:Kif1a UTSW 1 93056245 missense probably damaging 1.00
R0538:Kif1a UTSW 1 93043638 missense probably damaging 0.99
R0628:Kif1a UTSW 1 93019883 missense probably damaging 1.00
R1110:Kif1a UTSW 1 93023453 splice site probably benign
R1132:Kif1a UTSW 1 93056021 missense probably damaging 0.99
R1387:Kif1a UTSW 1 93055950 splice site probably benign
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1544:Kif1a UTSW 1 93074948 splice site probably benign
R1569:Kif1a UTSW 1 93058810 splice site probably benign
R1802:Kif1a UTSW 1 93066149 missense probably damaging 1.00
R1917:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1919:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1999:Kif1a UTSW 1 93060795 missense probably damaging 0.98
R2000:Kif1a UTSW 1 93054329 missense probably damaging 0.99
R2276:Kif1a UTSW 1 93068477 splice site probably benign
R2307:Kif1a UTSW 1 93078769 missense probably damaging 1.00
R2919:Kif1a UTSW 1 93046742 missense probably damaging 1.00
R3440:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3441:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3618:Kif1a UTSW 1 93077043 missense probably null 1.00
R3957:Kif1a UTSW 1 93025694 missense probably damaging 1.00
R4010:Kif1a UTSW 1 93022409 missense probably benign 0.42
R4013:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4017:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4115:Kif1a UTSW 1 93052538 missense probably damaging 1.00
R4386:Kif1a UTSW 1 93068550 missense probably damaging 1.00
R4538:Kif1a UTSW 1 93077047 missense probably damaging 1.00
R4608:Kif1a UTSW 1 93024646 missense possibly damaging 0.81
R4625:Kif1a UTSW 1 93042659 missense probably benign 0.00
R4701:Kif1a UTSW 1 93078835 missense probably damaging 0.99
R4794:Kif1a UTSW 1 93025727 missense probably damaging 1.00
R4830:Kif1a UTSW 1 93021209 splice site probably null
R4903:Kif1a UTSW 1 93021734 missense probably damaging 1.00
R4915:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4918:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4991:Kif1a UTSW 1 93078808 missense probably benign 0.00
R5028:Kif1a UTSW 1 93054327 missense possibly damaging 0.68
R5051:Kif1a UTSW 1 93076154 splice site probably null
R5073:Kif1a UTSW 1 93022505 missense probably damaging 1.00
R5103:Kif1a UTSW 1 93046696 missense probably damaging 1.00
R5314:Kif1a UTSW 1 93018498 missense probably damaging 1.00
R5481:Kif1a UTSW 1 93060244 missense probably benign 0.01
R5510:Kif1a UTSW 1 93041692 missense possibly damaging 0.93
R5610:Kif1a UTSW 1 93025728 missense probably damaging 1.00
R5643:Kif1a UTSW 1 93055767 missense probably damaging 0.98
R5808:Kif1a UTSW 1 93042698 missense probably damaging 0.99
R6027:Kif1a UTSW 1 93025643 missense probably benign 0.33
R6056:Kif1a UTSW 1 93024648 missense probably damaging 1.00
R6077:Kif1a UTSW 1 93054896 missense possibly damaging 0.54
R6120:Kif1a UTSW 1 93024574 splice site probably null
R6126:Kif1a UTSW 1 93019899 missense probably damaging 1.00
R6130:Kif1a UTSW 1 93036901 missense probably damaging 1.00
R6255:Kif1a UTSW 1 93019983 missense probably damaging 1.00
R6301:Kif1a UTSW 1 93054941 nonsense probably null
R6326:Kif1a UTSW 1 93076326 missense probably damaging 1.00
R6594:Kif1a UTSW 1 93021313 missense probably benign 0.00
R6653:Kif1a UTSW 1 93077698 missense probably damaging 1.00
R6791:Kif1a UTSW 1 93066137 missense probably damaging 1.00
R6853:Kif1a UTSW 1 93039802 missense possibly damaging 0.47
R7022:Kif1a UTSW 1 93066098 missense probably benign 0.31
R7059:Kif1a UTSW 1 93046829 intron probably benign
R7103:Kif1a UTSW 1 93077785 missense probably damaging 1.00
R7248:Kif1a UTSW 1 93041583 missense probably benign 0.35
R7259:Kif1a UTSW 1 93073810 nonsense probably null
R7424:Kif1a UTSW 1 93054317 missense possibly damaging 0.89
R7659:Kif1a UTSW 1 93046820 intron probably benign
R7681:Kif1a UTSW 1 93054944 missense probably benign
R7976:Kif1a UTSW 1 93039774 missense probably damaging 1.00
R8056:Kif1a UTSW 1 93054701 intron probably benign
R8420:Kif1a UTSW 1 93022419 missense probably benign
Z1176:Kif1a UTSW 1 93021316 missense probably damaging 0.97
Z1176:Kif1a UTSW 1 93022491 missense probably damaging 1.00
Z1176:Kif1a UTSW 1 93055697 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGGACCATGAGTCAGTCAGTCAG -3'
(R):5'- AGTAGAGTATGAGCCCCTGTGTTGG -3'

Sequencing Primer
(F):5'- AGGTTCTGCCAACCTCAGATG -3'
(R):5'- GGCTCTGTCACCCCAAC -3'
Posted On2013-10-16