Incidental Mutation 'R0848:Cntnap5b'
ID 77396
Institutional Source Beutler Lab
Gene Symbol Cntnap5b
Ensembl Gene ENSMUSG00000067028
Gene Name contactin associated protein-like 5B
Synonyms Caspr5-2, C230078M14Rik
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R0848 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 99772765-100485942 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100255163 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 620 (Y620H)
Ref Sequence ENSEMBL: ENSMUSP00000083944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086738] [ENSMUST00000188735]
AlphaFold Q0V8T8
Predicted Effect probably benign
Transcript: ENSMUST00000086738
AA Change: Y620H

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: Y620H

signal peptide 1 24 N/A INTRINSIC
FA58C 39 174 2.76e-16 SMART
LamG 201 338 2.84e-27 SMART
LamG 387 521 9.22e-27 SMART
EGF 549 583 1.14e0 SMART
Blast:FBG 586 758 3e-66 BLAST
LamG 798 925 2.12e-26 SMART
EGF 946 982 1.51e0 SMART
LamG 1023 1159 2.14e-13 SMART
transmembrane domain 1227 1249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185484
Predicted Effect probably benign
Transcript: ENSMUST00000188735
AA Change: Y306H

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139877
Gene: ENSMUSG00000067028
AA Change: Y306H

LamG 73 207 5.9e-29 SMART
EGF 235 269 5.6e-3 SMART
Blast:FBG 272 402 2e-42 BLAST
LamG 415 554 2.5e-11 SMART
EGF 575 611 7.1e-3 SMART
LamG 652 788 1.4e-15 SMART
transmembrane domain 856 878 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Cntnap5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Cntnap5b APN 1 100050754 missense probably damaging 1.00
IGL00477:Cntnap5b APN 1 100213743 missense probably damaging 0.97
IGL00505:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00596:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00846:Cntnap5b APN 1 100164223 missense probably damaging 1.00
IGL00895:Cntnap5b APN 1 100383585 missense probably damaging 0.98
IGL00948:Cntnap5b APN 1 100141357 missense probably benign 0.00
IGL01073:Cntnap5b APN 1 100076030 missense probably benign 0.08
IGL01523:Cntnap5b APN 1 100431779 missense probably benign 0.02
IGL01779:Cntnap5b APN 1 99967339 missense probably damaging 1.00
IGL02253:Cntnap5b APN 1 100164211 missense possibly damaging 0.75
IGL02628:Cntnap5b APN 1 100072069 missense probably damaging 0.97
R0166:Cntnap5b UTSW 1 100274361 missense probably benign 0.41
R0211:Cntnap5b UTSW 1 100478374 missense possibly damaging 0.82
R0281:Cntnap5b UTSW 1 100072153 missense probably benign 0.22
R0363:Cntnap5b UTSW 1 100274468 missense probably benign 0.01
R0514:Cntnap5b UTSW 1 99772786 missense probably benign
R0645:Cntnap5b UTSW 1 100072042 splice site probably benign
R1006:Cntnap5b UTSW 1 100383617 missense probably benign 0.00
R1349:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1372:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1474:Cntnap5b UTSW 1 100072089 missense probably benign 0.25
R1681:Cntnap5b UTSW 1 100076107 missense probably damaging 0.98
R1727:Cntnap5b UTSW 1 100213744 missense possibly damaging 0.91
R1760:Cntnap5b UTSW 1 99772810 missense probably benign 0.05
R1777:Cntnap5b UTSW 1 100370078 missense probably benign 0.10
R1939:Cntnap5b UTSW 1 99967348 missense probably benign
R1988:Cntnap5b UTSW 1 100072140 missense possibly damaging 0.92
R2069:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R2113:Cntnap5b UTSW 1 100274415 missense probably benign
R2148:Cntnap5b UTSW 1 100383474 missense probably benign 0.01
R2158:Cntnap5b UTSW 1 100390572 missense probably damaging 1.00
R2223:Cntnap5b UTSW 1 100213687 missense probably damaging 1.00
R2350:Cntnap5b UTSW 1 100379126 missense probably damaging 1.00
R3840:Cntnap5b UTSW 1 100383477 missense possibly damaging 0.50
R4329:Cntnap5b UTSW 1 100072163 missense probably damaging 0.99
R4609:Cntnap5b UTSW 1 99772847 critical splice donor site probably null
R4799:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R5129:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R5323:Cntnap5b UTSW 1 100383550 nonsense probably null
R5434:Cntnap5b UTSW 1 100072201 missense probably benign 0.02
R5579:Cntnap5b UTSW 1 100383395 nonsense probably null
R5579:Cntnap5b UTSW 1 100383399 missense probably benign 0.27
R5630:Cntnap5b UTSW 1 100072069 missense probably damaging 0.99
R5644:Cntnap5b UTSW 1 100383601 missense probably benign 0.00
R5761:Cntnap5b UTSW 1 100446894 missense probably damaging 1.00
R6042:Cntnap5b UTSW 1 100390592 missense probably benign
R6147:Cntnap5b UTSW 1 100050781 missense probably damaging 1.00
R6190:Cntnap5b UTSW 1 100379075 missense possibly damaging 0.80
R6248:Cntnap5b UTSW 1 100072102 missense probably benign 0.30
R6286:Cntnap5b UTSW 1 100255073 missense possibly damaging 0.82
R6306:Cntnap5b UTSW 1 100164146 missense probably damaging 1.00
R6336:Cntnap5b UTSW 1 100358669 missense probably benign 0.00
R6360:Cntnap5b UTSW 1 100431736 nonsense probably null
R6722:Cntnap5b UTSW 1 100478486 missense probably damaging 0.98
R6750:Cntnap5b UTSW 1 100274499 missense probably damaging 1.00
R6806:Cntnap5b UTSW 1 99940649 missense probably damaging 1.00
R6933:Cntnap5b UTSW 1 100383450 missense probably benign 0.01
R6957:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6958:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6959:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6961:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6962:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R7088:Cntnap5b UTSW 1 100160077 missense probably damaging 0.99
R7146:Cntnap5b UTSW 1 100050794 splice site probably null
R7165:Cntnap5b UTSW 1 100076162 missense possibly damaging 0.94
R7190:Cntnap5b UTSW 1 100431849 splice site probably null
R7376:Cntnap5b UTSW 1 99967269 missense possibly damaging 0.92
R7385:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R8053:Cntnap5b UTSW 1 100390677 missense probably damaging 0.98
R8080:Cntnap5b UTSW 1 100072203 missense probably benign 0.16
R8082:Cntnap5b UTSW 1 100379216 missense probably benign 0.00
R8271:Cntnap5b UTSW 1 100072107 missense probably benign 0.00
R8303:Cntnap5b UTSW 1 100141297 missense probably damaging 1.00
R8428:Cntnap5b UTSW 1 100383585 missense probably damaging 0.98
R9131:Cntnap5b UTSW 1 100050643 missense probably benign 0.22
R9144:Cntnap5b UTSW 1 100050787 missense probably damaging 1.00
R9522:Cntnap5b UTSW 1 100484622 missense probably benign 0.00
R9611:Cntnap5b UTSW 1 99967210 missense probably damaging 1.00
RF007:Cntnap5b UTSW 1 100164070 missense probably damaging 1.00
X0020:Cntnap5b UTSW 1 100431848 critical splice donor site probably null
Z1176:Cntnap5b UTSW 1 99967270 missense probably damaging 0.99
Z1176:Cntnap5b UTSW 1 100164228 missense possibly damaging 0.86
Z1176:Cntnap5b UTSW 1 100446840 missense probably benign 0.01
Z1177:Cntnap5b UTSW 1 100050706 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agaaatggaagtggatgggtaag -3'
Posted On 2013-10-16