Incidental Mutation 'R0848:Epb41l5'
ID77397
Institutional Source Beutler Lab
Gene Symbol Epb41l5
Ensembl Gene ENSMUSG00000026383
Gene Nameerythrocyte membrane protein band 4.1 like 5
SynonymsE230025E14Rik, 1700030C16Rik, Epb4.1l5, NBL5, Lulu1
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location119545037-119649000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119549954 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 696 (C696S)
Ref Sequence ENSEMBL: ENSMUSP00000128374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052404] [ENSMUST00000163147]
Predicted Effect probably benign
Transcript: ENSMUST00000052404
AA Change: C688S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000058966
Gene: ENSMUSG00000026383
AA Change: C688S

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
coiled coil region 482 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163147
AA Change: C696S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000128374
Gene: ENSMUSG00000026383
AA Change: C696S

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 420 429 N/A INTRINSIC
coiled coil region 490 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191162
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a number of different mutations exhibit prenatal lethality and mesodermal and epithelial-mesenchymal transition defects during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Epb41l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Epb41l5 APN 1 119567847 missense probably benign 0.03
IGL01983:Epb41l5 APN 1 119579084 splice site probably benign
IGL02085:Epb41l5 APN 1 119572856 missense probably benign
IGL02834:Epb41l5 APN 1 119623955 missense probably benign 0.22
IGL02975:Epb41l5 APN 1 119579081 splice site probably benign
IGL03001:Epb41l5 APN 1 119617644 missense probably damaging 1.00
IGL03331:Epb41l5 APN 1 119617419 missense probably damaging 1.00
R0096:Epb41l5 UTSW 1 119623911 splice site probably benign
R0124:Epb41l5 UTSW 1 119633640 nonsense probably null
R0128:Epb41l5 UTSW 1 119549902 missense possibly damaging 0.81
R0130:Epb41l5 UTSW 1 119549902 missense possibly damaging 0.81
R0241:Epb41l5 UTSW 1 119567779 splice site probably null
R0357:Epb41l5 UTSW 1 119609204 missense probably damaging 1.00
R0624:Epb41l5 UTSW 1 119623958 missense probably damaging 1.00
R0711:Epb41l5 UTSW 1 119623911 splice site probably benign
R1340:Epb41l5 UTSW 1 119549131 makesense probably null
R1401:Epb41l5 UTSW 1 119578904 splice site probably benign
R1416:Epb41l5 UTSW 1 119549876 splice site probably benign
R1452:Epb41l5 UTSW 1 119549166 missense probably damaging 1.00
R1646:Epb41l5 UTSW 1 119550022 splice site probably benign
R1889:Epb41l5 UTSW 1 119549172 missense possibly damaging 0.82
R1895:Epb41l5 UTSW 1 119549172 missense possibly damaging 0.82
R3082:Epb41l5 UTSW 1 119609262 missense probably damaging 1.00
R3742:Epb41l5 UTSW 1 119605243 missense probably benign
R4194:Epb41l5 UTSW 1 119608093 missense probably damaging 1.00
R4787:Epb41l5 UTSW 1 119595995 missense probably benign 0.00
R4983:Epb41l5 UTSW 1 119555071 missense probably benign 0.00
R6825:Epb41l5 UTSW 1 119620201 missense possibly damaging 0.54
R6943:Epb41l5 UTSW 1 119609129 missense probably damaging 1.00
R6944:Epb41l5 UTSW 1 119609129 missense probably damaging 1.00
R7334:Epb41l5 UTSW 1 119623949 missense probably damaging 1.00
R8553:Epb41l5 UTSW 1 119549941 missense possibly damaging 0.88
R8904:Epb41l5 UTSW 1 119620206 missense probably damaging 1.00
R8955:Epb41l5 UTSW 1 119642562 missense probably damaging 1.00
Z1177:Epb41l5 UTSW 1 119609211 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGTCACTACGATTGCAGGCAC -3'
(R):5'- CCTGGGGACATCAGAGCCTCTTTC -3'

Sequencing Primer
(F):5'- TACGATTGCAGGCACAATCAG -3'
(R):5'- CCTGCTCCAGTCAGTGACAC -3'
Posted On2013-10-16