Incidental Mutation 'R0848:Olfr994'
ID77399
Institutional Source Beutler Lab
Gene Symbol Olfr994
Ensembl Gene ENSMUSG00000075219
Gene Nameolfactory receptor 994
SynonymsMOR203-4, GA_x6K02T2Q125-46907515-46906571
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85429380-85436451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85430021 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 269 (N269K)
Ref Sequence ENSEMBL: ENSMUSP00000149417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099925] [ENSMUST00000214679] [ENSMUST00000217218]
Predicted Effect probably benign
Transcript: ENSMUST00000099925
AA Change: N269K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097509
Gene: ENSMUSG00000075219
AA Change: N269K

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 302 3.5e-5 PFAM
Pfam:7tm_1 41 289 8.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214679
AA Change: N269K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215758
Predicted Effect probably benign
Transcript: ENSMUST00000217218
AA Change: N269K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Olfr994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr994 APN 2 85430140 missense probably benign 0.00
IGL01325:Olfr994 APN 2 85430295 missense possibly damaging 0.60
IGL01634:Olfr994 APN 2 85430439 missense probably damaging 1.00
IGL01809:Olfr994 APN 2 85430154 missense probably damaging 1.00
IGL02586:Olfr994 APN 2 85430466 missense possibly damaging 0.80
IGL02711:Olfr994 APN 2 85430739 missense probably damaging 0.97
R0010:Olfr994 UTSW 2 85429895 missense probably benign
R0578:Olfr994 UTSW 2 85430673 missense probably benign 0.03
R1844:Olfr994 UTSW 2 85429921 missense probably benign 0.03
R1912:Olfr994 UTSW 2 85430260 missense probably damaging 0.97
R1959:Olfr994 UTSW 2 85430619 missense probably damaging 1.00
R2014:Olfr994 UTSW 2 85430352 missense possibly damaging 0.89
R2113:Olfr994 UTSW 2 85430086 missense probably damaging 1.00
R2290:Olfr994 UTSW 2 85430200 missense possibly damaging 0.64
R3622:Olfr994 UTSW 2 85430493 missense probably benign 0.12
R3918:Olfr994 UTSW 2 85430730 missense possibly damaging 0.64
R4175:Olfr994 UTSW 2 85430618 missense probably damaging 1.00
R4945:Olfr994 UTSW 2 85430551 missense probably benign 0.03
R6132:Olfr994 UTSW 2 85430146 missense probably benign 0.06
R6439:Olfr994 UTSW 2 85430724 missense probably damaging 1.00
R6713:Olfr994 UTSW 2 85430539 missense probably damaging 1.00
R7065:Olfr994 UTSW 2 85430179 missense probably damaging 1.00
R7089:Olfr994 UTSW 2 85430558 missense probably benign 0.00
R7467:Olfr994 UTSW 2 85430827 start codon destroyed possibly damaging 0.90
R8006:Olfr994 UTSW 2 85429974 missense probably damaging 1.00
R8021:Olfr994 UTSW 2 85430652 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAATAACTTGAACAGAATGGGCAATG -3'
(R):5'- ATCATACATATACATCATGGCCGCCATC -3'

Sequencing Primer
(F):5'- CTAGGTGAATACTCGTCTACTGAGG -3'
(R):5'- TCATGGCCGCCATCCTAAAG -3'
Posted On2013-10-16