Incidental Mutation 'R0848:Kcnb1'
ID77403
Institutional Source Beutler Lab
Gene Symbol Kcnb1
Ensembl Gene ENSMUSG00000050556
Gene Namepotassium voltage gated channel, Shab-related subfamily, member 1
SynonymsKcr1-1, Shab, Kv2.1
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location167095969-167190155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 167106267 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 220 (F220L)
Ref Sequence ENSEMBL: ENSMUSP00000147093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059826] [ENSMUST00000207917]
Predicted Effect probably damaging
Transcript: ENSMUST00000059826
AA Change: F220L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057981
Gene: ENSMUSG00000050556
AA Change: F220L

DomainStartEndE-ValueType
BTB 31 140 1.3e-14 SMART
low complexity region 150 162 N/A INTRINSIC
Pfam:Ion_trans 188 424 2.4e-50 PFAM
Pfam:Ion_trans_2 332 418 1.2e-13 PFAM
Pfam:Kv2channel 467 618 5.4e-48 PFAM
low complexity region 698 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144351
Predicted Effect probably damaging
Transcript: ENSMUST00000207917
AA Change: F220L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel and its activity is modulated by some other family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show reduced fasting glucose levels, hyperinsulinemia, improved glucose tolerance, altered glucose-induced electrical activity of pancreatic beta cells, and enhanced insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Kcnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Kcnb1 APN 2 167106207 missense probably damaging 1.00
IGL02945:Kcnb1 APN 2 167188388 missense probably benign 0.03
R0139:Kcnb1 UTSW 2 167105539 missense possibly damaging 0.94
R0144:Kcnb1 UTSW 2 167104547 missense probably damaging 1.00
R0238:Kcnb1 UTSW 2 167104969 missense probably benign 0.04
R0238:Kcnb1 UTSW 2 167104969 missense probably benign 0.04
R2869:Kcnb1 UTSW 2 167105935 missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 167105935 missense probably damaging 1.00
R3964:Kcnb1 UTSW 2 167104492 missense probably damaging 1.00
R3966:Kcnb1 UTSW 2 167104492 missense probably damaging 1.00
R4254:Kcnb1 UTSW 2 167105731 missense probably damaging 1.00
R4418:Kcnb1 UTSW 2 167105675 nonsense probably null
R4625:Kcnb1 UTSW 2 167188233 missense probably damaging 1.00
R4949:Kcnb1 UTSW 2 167105601 missense probably damaging 1.00
R5144:Kcnb1 UTSW 2 167105944 missense probably damaging 1.00
R5249:Kcnb1 UTSW 2 167105183 missense possibly damaging 0.95
R5849:Kcnb1 UTSW 2 167106026 missense probably damaging 1.00
R5869:Kcnb1 UTSW 2 167188071 missense probably benign 0.01
R6108:Kcnb1 UTSW 2 167105140 missense probably damaging 1.00
R6636:Kcnb1 UTSW 2 167105854 missense probably damaging 0.99
R6637:Kcnb1 UTSW 2 167105854 missense probably damaging 0.99
R6880:Kcnb1 UTSW 2 167105807 missense probably damaging 1.00
R7391:Kcnb1 UTSW 2 167105450 missense probably damaging 1.00
R7401:Kcnb1 UTSW 2 167188284 missense probably damaging 0.99
R7651:Kcnb1 UTSW 2 167188361 missense probably damaging 1.00
R7744:Kcnb1 UTSW 2 167188331 missense probably damaging 1.00
R7825:Kcnb1 UTSW 2 167105972 missense probably damaging 1.00
R7848:Kcnb1 UTSW 2 167106268 missense probably damaging 1.00
R7931:Kcnb1 UTSW 2 167106268 missense probably damaging 1.00
Z1088:Kcnb1 UTSW 2 167188061 missense probably benign 0.38
Z1176:Kcnb1 UTSW 2 167188402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGATGCGGAAGATCTGGACCAC -3'
(R):5'- AGCCGTGAAGTCTCTGGTGAGAAC -3'

Sequencing Primer
(F):5'- ACACGGCGCACATTCTG -3'
(R):5'- TGTGAAAGCTGCGATGACC -3'
Posted On2013-10-16