Incidental Mutation 'R0848:Clvs1'
ID77407
Institutional Source Beutler Lab
Gene Symbol Clvs1
Ensembl Gene ENSMUSG00000041216
Gene Nameclavesin 1
Synonyms4933402J24Rik, Rlbp1l1
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location9269293-9451691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9282003 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 149 (D149G)
Ref Sequence ENSEMBL: ENSMUSP00000103985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038841] [ENSMUST00000108348]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038841
AA Change: D149G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035649
Gene: ENSMUSG00000041216
AA Change: D149G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108348
AA Change: D149G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103985
Gene: ENSMUSG00000041216
AA Change: D149G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149848
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Clvs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Clvs1 APN 4 9281939 missense probably damaging 1.00
IGL01293:Clvs1 APN 4 9281559 start codon destroyed probably null
IGL01463:Clvs1 APN 4 9429818 missense probably benign 0.27
IGL03031:Clvs1 APN 4 9449385 splice site probably benign
R0472:Clvs1 UTSW 4 9281801 missense probably damaging 1.00
R0496:Clvs1 UTSW 4 9424241 missense probably damaging 1.00
R1541:Clvs1 UTSW 4 9281814 missense probably benign 0.00
R1992:Clvs1 UTSW 4 9281899 missense probably benign 0.01
R2901:Clvs1 UTSW 4 9281972 missense probably damaging 0.96
R2902:Clvs1 UTSW 4 9281972 missense probably damaging 0.96
R4321:Clvs1 UTSW 4 9282029 intron probably benign
R4934:Clvs1 UTSW 4 9424216 missense possibly damaging 0.91
R4946:Clvs1 UTSW 4 9281831 nonsense probably null
R4970:Clvs1 UTSW 4 9350857 intron probably benign
R5187:Clvs1 UTSW 4 9281865 missense possibly damaging 0.53
R5327:Clvs1 UTSW 4 9424261 missense probably damaging 1.00
R5605:Clvs1 UTSW 4 9281751 missense probably damaging 0.98
R5940:Clvs1 UTSW 4 9449443 missense possibly damaging 0.96
R6818:Clvs1 UTSW 4 9282014 critical splice donor site probably null
R6857:Clvs1 UTSW 4 9449433 missense probably benign 0.00
R7692:Clvs1 UTSW 4 9350739 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TTCACCAAGCCGATGCCTTCAG -3'
(R):5'- TGGGACCAATGCCAAAGATGATCC -3'

Sequencing Primer
(F):5'- GCCGATGCCTTCAGACTCC -3'
(R):5'- GAGAACAGATTGCCCTTTTGGAAC -3'
Posted On2013-10-16