Incidental Mutation 'R0848:Dlx6'
ID77414
Institutional Source Beutler Lab
Gene Symbol Dlx6
Ensembl Gene ENSMUSG00000029754
Gene Namedistal-less homeobox 6
Synonyms
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0848 (G1)
Quality Score156
Status Not validated
Chromosome6
Chromosomal Location6863334-6868568 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 6863665 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 96 (Q96*)
Ref Sequence ENSEMBL: ENSMUSP00000128585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031768] [ENSMUST00000160937] [ENSMUST00000171311]
Predicted Effect probably benign
Transcript: ENSMUST00000031768
SMART Domains Protein: ENSMUSP00000031768
Gene: ENSMUSG00000029754

DomainStartEndE-ValueType
HOX 32 94 7.65e-23 SMART
low complexity region 102 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159827
Predicted Effect probably null
Transcript: ENSMUST00000160937
AA Change: Q96*
SMART Domains Protein: ENSMUSP00000124204
Gene: ENSMUSG00000029754
AA Change: Q96*

DomainStartEndE-ValueType
low complexity region 26 59 N/A INTRINSIC
low complexity region 79 102 N/A INTRINSIC
HOX 171 233 7.65e-23 SMART
low complexity region 241 257 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171311
AA Change: Q96*
SMART Domains Protein: ENSMUSP00000128585
Gene: ENSMUSG00000029754
AA Change: Q96*

DomainStartEndE-ValueType
low complexity region 26 59 N/A INTRINSIC
low complexity region 79 102 N/A INTRINSIC
HOX 171 233 7.65e-23 SMART
low complexity region 241 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178206
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations at both Dlx5 and Dlx6 exhibit bilateral ectrodactyly, homeotic transformation of the lower jaw into an upper jaw, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Dlx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Dlx6 APN 6 6865143 missense probably damaging 1.00
IGL01081:Dlx6 APN 6 6867068 missense probably damaging 1.00
IGL03034:Dlx6 APN 6 6863807 missense probably benign 0.45
IGL03309:Dlx6 APN 6 6867289 missense possibly damaging 0.77
R1004:Dlx6 UTSW 6 6863665 nonsense probably null
R1694:Dlx6 UTSW 6 6867173 missense probably damaging 1.00
R1753:Dlx6 UTSW 6 6863665 nonsense probably null
R2076:Dlx6 UTSW 6 6867098 missense probably benign 0.00
R2293:Dlx6 UTSW 6 6867246 missense probably damaging 1.00
R4488:Dlx6 UTSW 6 6867207 missense probably damaging 0.99
R4574:Dlx6 UTSW 6 6865305 intron probably benign
R4942:Dlx6 UTSW 6 6863468 missense probably benign 0.28
R5102:Dlx6 UTSW 6 6865180 frame shift probably null
R5103:Dlx6 UTSW 6 6865180 frame shift probably null
R5104:Dlx6 UTSW 6 6865180 frame shift probably null
R5105:Dlx6 UTSW 6 6865180 frame shift probably null
R5736:Dlx6 UTSW 6 6863660 missense probably damaging 0.97
R7577:Dlx6 UTSW 6 6863423 missense probably damaging 1.00
R7995:Dlx6 UTSW 6 6867277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCATGACTACGATGGCTGACG -3'
(R):5'- AGGCTCAATGGGAACCACAAGC -3'

Sequencing Primer
(F):5'- acagcagcagcagcaac -3'
(R):5'- ccggcgTGGAGGAAGTG -3'
Posted On2013-10-16