Incidental Mutation 'R0848:Rsph6a'
ID77420
Institutional Source Beutler Lab
Gene Symbol Rsph6a
Ensembl Gene ENSMUSG00000040866
Gene Nameradial spoke head 6 homolog A (Chlamydomonas)
SynonymsRSP4, Rshl1
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19054690-19074447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19057670 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 255 (D255N)
Ref Sequence ENSEMBL: ENSMUSP00000046526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000035521] [ENSMUST00000076887]
Predicted Effect probably benign
Transcript: ENSMUST00000023882
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035521
AA Change: D255N

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866
AA Change: D255N

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 191 685 2.3e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076887
AA Change: D255N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866
AA Change: D255N

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 188 287 3e-18 PFAM
Pfam:Radial_spoke 285 433 4.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130328
SMART Domains Protein: ENSMUSP00000115900
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:Symplekin_C 1 92 3.9e-44 PFAM
low complexity region 125 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148861
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a sea urchin radial spoke head protein. Radial spoke protein complexes form part of the axoneme of eukaryotic flagella and are located between the axoneme's outer ring of doublet microtubules and central pair of microtubules. In Chlamydomonas, radial spoke proteins are thought to regulate the activity of dynein and the symmetry of flagellar bending patterns. This gene maps to a region of chromosome 19 that is linked to primary ciliary dyskinesia-2 (CILD2). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Rsph6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Rsph6a APN 7 19054868 nonsense probably null
IGL01656:Rsph6a APN 7 19054845 missense probably benign 0.00
IGL02997:Rsph6a APN 7 19054839 missense probably benign 0.32
R0396:Rsph6a UTSW 7 19074106 missense probably damaging 1.00
R0467:Rsph6a UTSW 7 19057669 missense possibly damaging 0.95
R0545:Rsph6a UTSW 7 19054946 nonsense probably null
R0603:Rsph6a UTSW 7 19065961 missense possibly damaging 0.66
R1943:Rsph6a UTSW 7 19074076 missense probably damaging 1.00
R2133:Rsph6a UTSW 7 19068106 missense probably damaging 1.00
R3713:Rsph6a UTSW 7 19057550 missense probably damaging 0.98
R3762:Rsph6a UTSW 7 19055331 missense probably damaging 1.00
R3826:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R3827:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R3828:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R4355:Rsph6a UTSW 7 19067078 splice site probably null
R4429:Rsph6a UTSW 7 19074063 missense probably damaging 1.00
R4524:Rsph6a UTSW 7 19066045 missense probably damaging 1.00
R4799:Rsph6a UTSW 7 19065858 nonsense probably null
R4896:Rsph6a UTSW 7 19057740 missense possibly damaging 0.67
R4906:Rsph6a UTSW 7 19068072 missense possibly damaging 0.92
R5004:Rsph6a UTSW 7 19057740 missense possibly damaging 0.67
R5637:Rsph6a UTSW 7 19054895 missense probably benign
R6066:Rsph6a UTSW 7 19065815 missense probably damaging 1.00
R7013:Rsph6a UTSW 7 19054895 missense probably benign
R7193:Rsph6a UTSW 7 19065647 missense probably damaging 1.00
R7689:Rsph6a UTSW 7 19068037 missense possibly damaging 0.64
Z1177:Rsph6a UTSW 7 19065931 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCACAAAACGTCAGGCTCAG -3'
(R):5'- GCTCCTAAACCTTGTGTGATGCCC -3'

Sequencing Primer
(F):5'- CTGACCAAGATCCTGAACCA -3'
(R):5'- AGGAACTGCTGTTCACACCTTAG -3'
Posted On2013-10-16